CR00842

CRIMIC CR00842

Gene ena

CG15112

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK79312

Images

Construct Sequences

sgRNA sequence
AATCCCATCGGTTTCAGGACAGG

Amplicon 5' Amplicon 3'
TTGCTGCTGCGAACTACTGAAATAATTTTAGTTGCATTAAAATTGTTTAAAAGAGTACAACACTTTTACAAAAGCAATTCTTTTGCTCACTCCGACTTCCTATAATTATTTTCGAATATGTAGTATCCAATTTATGAGATATAAATCGATTCGATTGTAAAAAACAGAAATTTAAAAAAACTGATTGACCGCTATTGTTTCGCAGTTTCTCATAGTGTGCAGAAAAAAAAAACTTCACTTTCGTTGCCACGAATTTCGATGCAAATCAAAGCGGACAGGCTCATAAGACTTAGCTCCAAACTGTCGGTGGTTATATAAGGCCCTGAAACGGCGCACAGCTGTGCCAGCCGCCAGAGTGCGACTCGGATTCGGATTGAGATTCGTCCGTCTGTCCAGCCGTCCGTACCGCCGATCTGCGCACTCCATTTAAGTGCAAAACTACTTGCGGCTTTTGGCCGGGCCAAGTCTGTAGCGAGAATACTGCCGACTCGACTCGTTTGGCGGCTGCTCTCCGTCATTATCTCTATGTGTCCCCCAGTAACACACAACTCGGAGCAACTTGGAGCAACTTGGAGCTGCTCAGGCAACTTGGAGCGGTGCAGGCTAGCAAAAACAAAAAAAGGGGCAGAGAAAAAAAGAAAAAAAAAAAGAACGGAGCTATAGGATAGAAAGAACACCACATAGCCAAGTTGAGCAAAAGGCAAGGCAACTCGTCATCGCCTTTGCATTTTTCCAATGAAGGCGTTCATTTGTCGCTGGCCATGTTTACTTCACTGGCTGACTTTAATTGTCAACTCAACTGAGTGTCCCGGGGGGAGAAAATGCTAAAGGTTGAATGCAGCATATACACGTTCATATTAGAACTTTCATTAGAATCATTTAATCGGTCCGTGCGACTCGAGACGATCATCTGGCTGGATGACAGGTGTGCGGGCATACAAAGAAATGCATTGCACTTCCTGTCCTGAAACCGATGGG ACCGATGGGATTAGAGGGGAGTCGAGGGTATACATAGATCAAAGCCCTTGCTCACTTGAGGCGTGTGAAAAGTCTGGAAGATCACGGTGCAGTAAAGTGCAGTTGAATGAGTTCTTCAAGGGGCAAATTGTAGAGCCGATCTAATGATCTGAAAACGACTGCTCATTGCGACATTCTTTCTGGGAAGTCTTAATCGAGTCTAAGAAGTTTTTTTTATTATGACGGAAAATCGATTTCTATGAATATATGTAGAAGCTTTCCATAGAACAATATATACTTTTTACTTCCAATCCCACGAAAGCCATCAATAAATTTGTATCTCTTTTATTGAACTCGTTTAGTGCAAATAATAAAGTTGCCAAATTTGACTAATTTGTTAGCACAACTTCCGTTTCGTTTCCCACGATCTTTTAAGACTTTAAAAGAGTTAACATCATAAAATGGAATTTTTGTACATACATATATGTTTCTCGCACATTTTCATATCTTTTCTTCTCAAGGCAAGGGCTATTCCCTATAATAAATTTTCAGCTCGAACTTCTTGAAGTGTGTTAAGTCCTCATCATTTCCATACACATTCAAGGTTCCATTCCATACCATTTAAGTCAGCCAACTAACCATAATATTCACACTTATTTCTTGCAGTGAGCAGAGTATTATCGGGGCGCGGGCCTCTGTGATGGTGTACGATGACAACCAGAAGAAGTGGGTGCCATCG


Search Again