CR00841

CRIMIC CR00841

Gene PAN2

CG8232

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK79311

Images

Construct Sequences

sgRNA sequence
GTGGGTCAAGGGGTCGCTTTGGG

Amplicon 5' Amplicon 3'
CGGACTGAGCACTTCCACTTTTTCCGGTGTAGATGCGCACATGACCATAGCCTCCGAGGTGACGCCGCGCATTTTGGCCGGCTTCAGGTTACACATGACCACTACCAGACGGTTCTGCATCTCTTCCAGGGGCACGAACTTCACCAGACCGGACACCACGGTGCGTGGAGCCGCCTCGCCGCAGTCGATCTTCTCCAGATACAAGCTGTCGGCGTCGGGATGGCGACCCACCTCCACAATCTTGCCCACGCGTAAATCCAGGCGACCGACGTCGACGGGAGCCTCCGGAGCGGCGGCGGGCTTCTCGGCGGCCGGTTTCTTCTCCTTGGACTTCTTTTCCTTGGGCTCCTTGGCCGGCTTAGGAGCCGGGGCAGCGGGTGCAGCGGTAGCAGGTCCAGCCTCTGCCGGCATAACTACTGGGGCCGCACTGGTGCAGAAACCCCGGGCTCCAGGCACCGGAATCTGTTTCTTGCCATTTCGCAGCTCCAGCTGCACCAGCTGGGCCAAAGCCGCCTCAACTTCCTTGGCCAGTGCAGCGTTCTCCTTGATCAGCTCCTGCTTCTGGCGCTCCACAAGTTGCTGCTGGATGCCGGAAATCTGGGGGGCAGTAGGTTATCGAGTGTTCGCAGGCGCTGGCAGGCGGAAATACTTGCCTCGGCTTCAATGGAGTTGATCAGCGCCTCGGCGCGCTCGTTGTTGCTTGCAATCTGCTGCAGATCGGCCATTGTTCTTTTGTTTCTCGCGAATTTTGAGCAATTCTGGCCGTAATTTTTACATGCGGATCCCACAGTCGTGGCAGCTCTACGCAGCATTGCAGTGCTTCTTCTTGCCACGCACAGTGGCGTCGCGCAGCGTTGGACAGGTAGTTCGTTGGCGGAGAAGCGAGAGTATTTTTACATCAGCCCTGCCAGGGTCACTCTAATCGGTGCAACGCAAAAACGGCTGGCAGTTTTGAGCGAAATTTGTTAAAAAATAAACAATAAAAAGTCGCGTGGGCATCGGCGTGCGGCAGATGGATTACGTGTATTGCGGCACCGACCCCATCGGGGCCTCCGAAGACATACTAAGTGGGTCAAGGGGTCG TTTGGGGCCAACGCTCACCCACACGCACACACACACGCAAGCCAGCTAAAGCTTTCTCCTTTGTTTTCTGTTTACTTTTTGAAAAGGTGTTTATGACGCGGGATCTGCGCCGGGAAACGGGCACTTTTCGCCCAGCTTCAATGGATTCAACATCGGCACCACCGATCCGGAATATGTGGAGCTTGTGCCCGTGCTTGCCGACGGCGGGGAGCACTTCGGCGTTTCCAGCGTGGCGTTCGACGACTACGAAGAGCTGCTGTGGATGGGCAACCAGGGCGTGAGTTCCTCGTCCAGCCTGCCAGGCTTACTAATCCTGAATCTTCGCTCCTTCCCGCAGGGCCACGTCACATCGTACTACACAAACTCCATGCAGAAGTACACATCCTTTCAGGTCCACGCCACCGACATTGTGCGCGACATCTCCACCCTGGACTCCGGAGTGCTGGCGCTCACGCAGACCTCGCTGCGTCATCAGATCCGCAGGGGTCTGCCCAAGTTTACCTTCAAGTAAGCCACCGCGCTGGCACAAAGATTCCCCGAAAGTGAGGTTTCAATTTCTTGCAGATCGAACAACATGAAGGAGATGGTGAGCATGCTGCAGCTATCACCGCATCGTCTGGTCATGGCCGGACTGCAGGACGAGCTTATCGACTTCGACCTGCGCACGCTCAAGGAAACCCGCATAGAGCATGTGGGTGCCGGCGGATGCACGGTGCTACGCAAGAATTCACGTTATCTGTTTGCCGGCGACCAGCTGGGAACGGTAACGTTGCGCGACCTGAACAGCCTGAGTGTTCAGCACACAATCAAGACGCACACCAACATCCTTTCGGACTTCAGTGTCCAGGGAAATCTGCTAATCTCTTGCGGCTACAGCGGAAGGCAAAATAACCTGGCCATCGACCGCTTCCTAATGGTCTACGATCTGCGCATGCTGCGCCTGATCGCGCCCATTCAAGTGATGATTGATCCGCAGATGTTGAAGTTCCTGCCATCGCT


Search Again