CR00839

CRIMIC CR00839

Gene clos

CG42600

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 no band OK80680

Images

Construct Sequences

sgRNA sequence
CATATGATGCCCGGTTTACCGGG

Amplicon 5' Amplicon 3'
AAGTTCCTGGCTGCTGATCCGAAGGTACATTCCACGCAGATGTGTTCCCGAAAAGTATTGCACTGTCCGTATCCCCGTTTCCGGGGAAATCTCATAGATGGGTGATCCTTCACGGGCCTGGCTTACGGGCTCTGTTAGATTGTAGCTCACTGCTACGTAGCCACGCCCAGCGAAGGCCAGGCAATCCAGAGCCACTGCCTTAGGTGTTTCCAACTCCACGAGGAGCTGGTAGTCCTGCTCAGCTGGACGCCAGGTATAGACGGCAAAGTGACGCACTCCTGCGGCATTTTTATGCAAGGCCGTAGCGTACTTGACCGTGGGCAGTTGGAGGATGCAAATGTCAAGGGGAAAAGACACCGGCACGGAGGCCACTCGTTCTAGTCCATCGAAACTAAAGCTAGCTGGAAGAGGCATAAAGTGTTTTAGACAATAAGTTGCACAAACACTAATCACAAAAGATTCCTCTTCAGCTTTTTGTACTTTCATCTTTAGGATAGAGCCGTAGGTAATCCGTCGCCGCTGACTAAACCAAACAATTCTTTCTAACTCTTCGTTAGCCATGGCCGATGAGGAGCTGCAAACCTACCGTCGCTGCGTTGGCCTGCAGCTGGAGGAGCTGGAGCTGCTGAGCTCCATATACTGCGCGCCCGGAGAGCTGCATATGCTCGATGCCGGCGTAGTGGCTGATTTCAATGAGTTTCTCAAGGATGATAAGACAAAACCCGCTACTAGCCTTCTATCCCATTTGGAGTATGTGGTCAAATTGACTCTACCAGGCAAACAGTGCGTGGAAGTGCGAGTGGAACTGCCGCACCTATATCCGCTTTTGGAGCAGGCACGCGTCAGTGTACACACTACGCTACTGGGAAAATCCAAGGAGCAGCGCTTAAAGAATGATTTGGAGCAGTATCATGGTGAAAGGCGGGAGGAGGACGCCGAGCCGTACATCTTCCAGCTGCTGAGCTGGCTGCAGGACCGCATCGAGGATCTGTTAAAACGACCAGCTTCCGAGTTTGAAGTGCAGCAGGTAGCATCATCAGACCCGCAACAGCCACCAGCTACGGAACTTCAGAGAATTTGGATTTATTCGCATCACATCAAATCCAGTGCCAAGCGGCAGGAGCTGATTCGGCAGGCCCGACAGTTGGAGCTCACAGGATTCAGTAGACCCGG ATGCGTGGAAGGTGATTCGGCAAATGTACAGGAATTCTGGCGCACCATCAAGGCCCTGCGCTGGCAGAAGATCAGCGTGGTGCGGACGGAGCCTCGGCAGCGCAAGCGGGGATTCGAGGACTTCAGCGAACAGCTTTTTAATGCCGAAGAAGGCGTCATGAACATGGGCCAGTTCATTCGATTCCTCGAAGCCCACGGATTTGGCTACATGAAGTCGGAATTGTTTGGTTTAGCCTGAGCACTGGATTTCCCATCAAAATTTAACATGTTAATAAAGTTTGTTATATCATTTCAAACCTTGGTCGAAAAACTGAGGCACAGCAGTCGCCCGTTTGTGGAGCATCGATTCCTGATCTGAGTTCAGGAAGTGTGTGGGATAGGATTCCCGGAAGTTTACTTCAAAACTGATCACGCGGGCGATCACAGCCGCAAAGATCAACAAATTGCAACAGATTTGATACATATATTTATTTTGTGTAAACTATACAAAACGAAACATTCAAACTGTAACACGTGCACTGGTTGCAAAATAACTTTTACTACCGGCCATGATATTTTACGGTTCTTAAAGCTTTATTTAGTATGATTGTCATATGTTTGGTACCCTATATCATAGTGGGTGTATTAGAGCAGAGAGAAGTTCGTATTTTGGTACATTGGCTTTTAAATGTATTATTTGTTTCTCTTAAATTTCTTTTATATAAATCCGTCTGCCTCGATTTCTGATACAAATTCATTTTCAACTATCTTCGTTGACTTGGCCGATTGTTGTGCCGACGACATATCCTTGCTTATGTCTTTTTCTAAATTTCCTGCCTTTTGTGCTGCCTCTGAGGTTCGTTTTCCATTCTTCATAAAGGCACAGTAGCAGCAGTGGTCTGGTGATCGAGAAAACTTCTTCATTTGGGTGGCGTCTCGCCATCGGCGAACCCAAGAAATTTGGTAGTAGGCCCTTCTAAAGTTCTCATTGTTGAAGCCATAGATCAGCGGATTGACGGC


Search Again