CR00837

CRIMIC CR00837

Gene Tif-IA

CG3278

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 short band OK80679

Images

Construct Sequences

sgRNA sequence
AGCAACCACCGGCCTCTACCAGG

Amplicon 5' Amplicon 3'
GGGCGTACCAACATGCTAGAATTTGCCTGTAGAGTCTGTGTGCTGGATTCTCATTCTTCTAGCTTTTATAGTTCCTGAGAACTTGACGTCTATACGGTCAGACGGACATGGCCAGATCGACTCGACCATTGCTCCTGAACAAGAATATATATACTTTATATAATCGAAAACGCATCCTTCTGCCTGTTACACAGTTTTCAACGAATATAGCATACCCTTTTACTCTACTAGTAACTGCTATATTAAATAAACAAAACTGAAAATTTAACTCACAGCAAAAACGACTTATCGTTTAGATAAAAAAAACATTTAATAAGAAATAAACTCCATTATTTGCTTCCCAATTTTTTTTATCTAACTCGACACATTATTTATTTCGGTTCCGCGGACTACCTGATTGGTCCACCGATACTTAGTACAGTAGACAACATAGCAGACGACAGCAAGAATAGAAGAATAGAGGTGCATTATCAGCTATCGTTAGAAAAACCCAGCACAATGTCTAGGTTTATTGAGACGTCACAATTCTCCAGAAGAATTCGCAATCTTAACAAGCCAGATAATTGTCACAGAACCATAAGTAATAAGATTGTAGAACATGGCACTAGAATCCCACAAAAAGAACCAGAAATGGTTATGACCTTCGTGCGAGGTGTACTACGACTTGCCTCGTCTACTGGAAATCAAAGAGCCAGTCGAACCAGAATTCAAAGCCTTTAACCTGCTCTTCGCAACACTTCATTTATAAAAAGACAACCACCAATTCCACCCCCAAGAATTCGAAATTACCAATTTGATCAGCAACCACCGG AACTTCGGTTTTCACCTTGCACAGCCTGCAGCTGCCTGCATTTTTAATAAAGGCAATAGGTATATGATATGATTTTTAACATTATTTTATTTAGAATAACAAGATGCGTAACAACGGACATGCATTGGTTTTCCACTATGCTGCCACTTTTTTTGGTGACGGTCAAAATTGCTCTCACTCCGCTCGCTTAAAACGATTAAGTGAACATGACATTGTGTACAAGATACCATTGTTTGGCTCATACTGTATATTTTAAAAAAGGAATTGTAATCTGCAACACCAAATTATGCGTACACTTAAAAACACTGAAGTGAACCTCCTGTGAGCGGTTCTTACTCCTGAGTACAATTTTGAGATGACATAATCAAACAATTCAATAAATATAGTTTTTTCGTGTAACTCAGTGATATCAATTCTCCACTACAATAAATGTTTCTGTATTGTTTATTTCTGTTACAGATTTGCTCTTCCTCCAATCCCTCCAACTATCGCGCCTTGCTATGTGTCATTTAAATCCCCTGCGGTATTGTTTAGCCCCAGTGGCCACAGCATTTGCTGGTGTTACAAGAACTTACCAGCTGGCCTATTGTCATACTGTTTTGGAGCGCAACGCTCGCCGTAAACTGGCTACAG


Search Again