CR00835

CRIMIC CR00835

Gene CG6686

CG6686

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK79310

Images

Construct Sequences

sgRNA sequence
CAAGGGCGATTGCCGTAGGCGGG

Amplicon 5' Amplicon 3'
TCCCTTTCACGTTCTCTGCCAGATCGCTTGCGGGCGTCCCGTTCCCGTTCGATCTCACGCTCTCGCCTAGACTCATATTCGGCATGCTTGGAGATTTGGGGTGGTGGAGGAGCTGTGAGCTCCCGTACACGTTCGCGTTCCCGCTCCCTCTCGCGCTCCCTAAGGCGTTCTTTCTCGCGTTCTCTGATACGTTCCTTCTCACGCTCTCTCTCGCGCTCCTCCCGCTCCCTGAGACGCTCCTTCTCACGCTCCCGTTCGCGCTCCTTTTCCCGATCCCGATCCCTCTCCCGCTCACGATCTCGTTCTCGCTCCCTTTCTCTTAGGAGTTCACGATCGCGTCCAGAATCCCGCTCCTTGTCACGATTGGACGATTCTCTGGCGTCCCTCAACTTGGCCTGCGCCTGCACCTGCGCCTGTACCGGCACCTCCACGCAGTCGGAACCTGGAAATAGGGAACACCGGTTAGAACTGTCTAATCATCACAGCTGGCGAATCGTTTCAACCACATCTCCGCTTTCCCACTCACAATCTGCATCAGCAGCGGGATACCTGAAAAAAAGGAGAAACATGGAGAAACGCAACGGTGGTTTTAGTACGTTCGGAAATGGTAAAGTGCAGCACCAAGACAATTGCCGGGCAATGGGCGGTCCGTCAATCAGAATATCGCTTTTCCGCCGGATC CAATCGCCCTTGAGCCTGGCCTGCACTTTGTGTGTGAAATATAGGGCAAACACTTACTATCCGAGTCCGATTCCTCTAGGGAGATGACCTCGTTCGCGCGCTCGCGCTCCTTTTGCTTGTGGTGCTTGTGGCGGTGCTCCTTGTGCTTCTTGTGCTTGTGGTGTCTGTGCCGCGACGAGGAGTCGTCGGTGAGATCCAGTGTGACATCCTCGTCCTCTGTGACGCGCCGCGGTCGCTCCGACGATCGCGAGCGATGACGGTTCTTCTTGTCCTTCTTGTGTTTCTTTCCCGACGACGAGGAACCCATATTTATTATTATTTTCACAACAAAATACAGAAAATTTCACAAGAAAAAGACGCCGGTGTGACCGCAGTTCGGGAAGCGGAAATATACCAGGTGTGCCACGGTAAAATTAAATGCCAATCACAGTGATGCGCGCACAAAGCCACCGAAATTGTTTAAGATATTAAAACTGAATGTAATTATTAAATTATCACGCAATGTAGTACTTCGGAACTTTTTATTTGTTAAAAGGACCTTTTTATTTAGAATTCGTTTTGTTAAAATTACCTTTTTGAATGACTAAACTTACACCGCCTACTCTTCTTCTTATTTTTTGTTTTGCCATTCACCACGAACTTAATAACAACTTAACACGCGGAGATCTCCACATAAACAATGGAAATTAAAGTACGTAAACAAATTATTTGCGACCTAAAACTTATTTCATTTTGATCCCCGTAGAAGTCCAAGAAATCAAAGAACGACAAGAAGTCCAAGGCGCCCAAGGAGTCGTCCGTTTCGCTCAAACTGAACGCTTTGCATCGCAAGCAAAAGGAAGTCGCCCGCGTGCTCACTTTAAAACAAGAAATATTACTGAAATCGGGTGTATCCTATCTGGAATATTATGAGATTCTGGCAGAAATCGAACGACTCAACGGCCTAAAGG


Search Again