CR00834

CRIMIC CR00834

Gene CG10188

CG10188

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK79309

Images

Construct Sequences

sgRNA sequence
AGATATGCACTAAGGTTTCGGGG

Amplicon 5' Amplicon 3'
CCCGGATGCGTCCTTTAAGTTCAGATAACTTAAAATCCTTTTTAGAAGATCAACAGATAAACCTAATAAATCAAGTTTGCTTACTAGAAGAGAATTATTTATAAAGACAAATGCTTTACTAAAGTCAGTGTAGATGACACCTGTTTGAATATTATTTCTGAAGCCCTGTATTACGAAGGAAGTTAGCTCCAAAAGGTTATTGGTTGTTTATCTGCGTTTCTGCTGACATGGTGATATAATTGACCTACAAAGGCGCTGCAAATGAGTAGTGATAACATTTTCAAAAACCTTTGGAATAGCCGACAATTTAGAGATTCCTCTGTAAAATCCATTTCCGACTTAATTTTGAATGCATTTTTGTTTAGTATTATTTTAAACTTTCAACACCTAAACACTTTTGTCTAAATAATTAAATAATATTGGCAAATTTACCTAATCAACAGGGCCAGCCATGTTGCAGGTATACAAATATCTGAACTACTATTGCATTGCACACTTATGGCTTTGCCAACCCACCCCCGAAACCTTAGTGCAT TCTACCTCCAGTGCTGTTCCTGGCCGACCTTCGTCGCTGCTCGGTGACGCGAATGGTTTCCTGCTCCTCGCTGTCCAGGCTGGATAGGCTGACGCTCTTGTTGGTGCAGTCGCCAGCGCCGCTGCCATCGTCCACGGCTGTCCAGGATTTCCGGCGGTCTGTGTGAAGAAACTGGCACTGCTGCGGTGCCGTGGAAGACCACATGGCGTAGTTGGAGCCACCGGACGCGGGACCCGTGCCCGTCCCCGTAAGATCGGGCAGCGAAGTACTCAGTATAGCTGCGCTGAGCAGTCCATGATTGGCCAAGCTGCCGTCCTGCATGTGCTGGCTAGGCGAGGAGGAGTTCTTCATCTGGACGACCGTTTCGCGGATGTTCTGCAGCTGGCTCAGCGTGTCCTCGAATATGTTGTTGTACTTGGAGGCCAGGGCGGGACTGTGTGGCGTCACATTTATGGTGGGTATCATGTTGTTGTTATTGATGGTGTTGCTGGCAGGATTAGATGCTGGTGGCGGAGCAATGGGGGCGCGCGCTGGACCAGGAACGGGTGCGTTTATTACGGGTATGCAATAGTTCTGGCTTTCGATGGAGGCGCCTCGGTTGGTAGAGCCACCATTAACCAGCGCTTCCGAGGACTCGCTGCAGTTGGAGTTCAGAAAATCGGTGACCACATCATTGTCGCTGTCCTCGCCCGCGTTGTCCATAATAGGGTCTACTGAATTCTCTGCGTTTTGGGCCAATTTCCTTTGTTTAGCGACTGTGTTCTATTTTACAGCTGGCTGCCTAGAAAAAGAAAGTTTCAGTATACAACGCACACACACTCAACCGCGACGGGCACCATACATGCATATATGTGTGTACATACGTACATATACACTTGTGTATGCACTTGCTTTTTGCTATTTATTGATTTTCCCGCCACCCCCGAAAACACCTTGTT


Search Again