CR00833

CRIMIC CR00833

Gene Hakai

CG10263

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK79308

Images

Construct Sequences

sgRNA sequence
GAGTCTCCTCCCCTATTGAATGG

Amplicon 5' Amplicon 3'
CTTGCCCTGGTGACATTCCTGCGCATTGGCATTGTTGATCCTGGTCAAATTGGCCAGCGTGAGCGTCGAGTGGCCGCCGTGGATGGCGTTTTGGGCGGCGGCGGCGGATCCTGGTGGCGGTATACTACCAATACTACCGATGTTACCGACACCGCCGGTCAGTGGCAGCCGCGACAGGACGGGACGGGACGCAATGGAGGCGGAAACGGATATGGGGACAGACGACTCGGAGAGCTGCAAGGGGCAAGCGGTTGTTTTTTTATAGACAGGACAGCTTAGTTTAGGAGCCATAGCTACCACTCGCCTTGCGCTGCTTGTGCAACTCCAGGCCCAGACCGACGCCGCCCAGATCCGTCATTTTTGGCTGCTCCGCCATGGCTGACAGCTGCGGCTGTGGCTGCAACGGTGGCGGCTGCGGCGCCACATGTCTGTGATTGATGTGCGCCTGCAGGTCGCGTTGCGAAAGGTATGTTCTACGGCAGCCGGAGCTGCCGTAGCGACTGCCGCCGTGCGTGCACATGAACACGGTGCCCAGGCCACTCTGCTCCACGCGCAACACCTTGTCCGTGCAGCGGGGACAACTCTTGATGGGCTCGGCGCGGGCGCACTTGAGGCAAAATACATGCTTGCAGGGTATCATGCGGCCGTAGACGAGGATCGGCTTGTCGCACTGATCGCAGCAGTGGATCATCGGGTTCAGCACCTTCTCGCCGATCAGGCTCACCTTGTGGTTCCACTTAAGGCGCAGCATCGGCTCCGGCGGTCCGCGCGAAAGCGTGGTGAAAGTGGGCGCCTCCAGTTGCGATATGTCCGCCTCCATGTCGACTGCGCGGGCGAGAGATAGCGAGATAGCTTTGTTCAATGCTTCAAGTTTGGATACCAAGGAATTGGTCAAGCCAAGATGTTAATCAATTTAACTATCTTGGACAACCATTCAATAGGGGAGGAGACTCACTTGT CTTGTTTGGCTCATCACGGGCGGTGGCACTTGCTGCAGGACCTGTGGCTGTTGCGTCGCTGGAGTCATGTTCCCGCTGGCGGCGACCGCTCCTAGCGCACCGTGCGGCAGGGGCTCCTCCAGAGCGCCGGGCGTTTCCAGTTCGCCGTCCTTGTCGAGCTCCTGCATGACCGAATCTTCGGAGGCGTCCAGTCTTCCCGGACTGTCCTCCAGGGCTGCACAGCTGCTGGCCGCCAGGGCTGCGGCGTCGGCGATGCTGCTGTCGTCGATTTTCTTGCCACGACCGCGTCCTCGGCCACGTCCGCGCCCGCGAGCCCTGGTGCCACGCCCTCGTCCGCGGCCGCGCTTCACTTCCTCGGTGTCCATTGTTCACTTGTACTTGCGTGGGATTTTATGCCGGTTTTTAAGTTTTTCGGTTTTTGTTTAGCTCCGCATTTGCGTTTGGCCAGGGTTGTCAGCTGTTCCCACATACGTGCAGTAACTTAGGGTGACCAGTCTGCG


Search Again