CR00832

CRIMIC CR00832

Gene CG10338

CG10338

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK79307

Images

Construct Sequences

sgRNA sequence
CTATAGGCACTAAGAAACTTAGG

Amplicon 5' Amplicon 3'
CATTTCACGCAACGCTGACAAACTGTAATTTTGCAGCGTTTAAATCAAATATTTAGTATGACCGAATCCGGCTTGATGCAAATAATTCACCACCTCCAGCATTCACCGCGAAACGCACCCACTGCACAGCTGACTGATAACACAATCGGAAGGGGAGAACTTCATTTTGGGGTATATTTATTTTGGGCCACAATTAGTTGCTAGCATTTGATTGAAGTAGCTCCAGCTCCATTGGCTTGTTTGTAAAATGCCCTAGAGTTCGCTTTCCAACGCCGCGTTCATTGATTCGTTCGAGTTCAGTTGCGCTAGTCGCTAGTTCGATGGCTTTACGCGGAATCCCCGCCTGAGATAGACAGCCAATCTAACTAACTAAGAAGCGCTGGTTGTGGGTGCTAGTGGAGCCAGGTGGGTGGTGCTTTACTGCTGGAGTCTCTGAAAGCCAGACAACCCAGCCAGTCCCGGATAGGCCATAAGTCATAATTTCCAGACGGCGCACAGCTACCAAAGAGCCAGGCACGCACAGCAAAGATGAAAATCCATTTTCGGGAACAGTACGGAAGAAAGGGGGAGGAAATCCTCTATGTGACGCCAGCAGGTGAGCAAATCGATCAAACCAACAAGCCAAAAACCTTGCAGGCGAAAATTCAGTAGCCATACAGCAGCAGCTATAGGCACTAAGA CACCATTGGTACTGTTCAAGCTTCAATTTCTATTAATTATTAATCTTGTTTATTATTATTATTATTTTTGTTTGGAATTATGGCGTTTTACTTGCAATACCCTATATTTTTTATAGCATATCGACTTTTCAGACAAAATTTTGTTCAATGCCATCGTTCTCTTTGCTTTGTTATTTATTTATTTAGGTAAATGTGTATAAATATATTCTGAAACGATTAGGTTGGCGGTTAATTCATTAATTAATTTGTATTTCCAACTCCAGATCAGAGCAACATTGTGCGTGTGCCGCTGCGTGGGGATAAGCTGGTCATCCAGGAGAAGTTCCTGCTGTTTCGCGTGCTGCAGAAGGTCTTCCTGCCCAAGGGCTATCCGGATAGTGTCAGCGAGGACTATGCAGCATACCAGATCTGGGACACGGCCCAGGCCTTCTGCAGCACCATCTGCGGCACCCTGTGCACACACGCCATCTTGAAGGGCATCGGCGTGGGCAGCGAGAACATCAATGCCTTTTCCGCAACGGCGACTTGGATCTTGAAGGAGGGCAGTGGTCACGTGGGTCGCATTGTGTTCGCATGGTGGCAGGGCTCCCAATTGGATGTGGACTCAAAGAAATGGCGCCTGCGTGCGGATTTTCTGAACGATCTGGCCATGGGCATCGAGATCTACGTGCTTCCCAAGTATCCGCATTTCAGCACCCAAATCCTGTGCTGCTCGACCCTGCTGAAGGCGATTGTGGGCGTTGCCGGAGGTGCCACTAGATCGGCATTGACCCAGCATCATGCCTTGAGGGGCAACCTGGCCGATGTGGCATCCAAGGACAGTTCACAGGAGACGTGCGTGAATCTGGTGGCCTCCTTTGTGGGCCTGTATCTCCTCTCGCTGATCAAGAGTCAGGCGGTCCTGTATACCATATTCTACGTGGTGGTCAGCCTGCATCTGTATGCCAATCTGAAAGCAGTACGCGCAGTATGCTTGCGAAGCTTCAACGAGTCGCGCTATTTGATCGCCCTGGAGGAGTTTTTC


Search Again