CR00830

CRIMIC CR00830

Gene und

CG4008

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK no band80678

Images

Construct Sequences

sgRNA sequence
CACAGTGCACTGCTCGCATGAGG

Amplicon 5' Amplicon 3'
TCTTGAGCTTTTTGTGCGCCGGCTCGCCAGAGTCACCATCTCCGTCCGTGTTCTTGTTGTCGTTGTCCCCATCCGCATCCTTGCCATCACGATCCGCATCGTTTCCCGGATCCGAGGTGTCGCTGTCCTTCCGCTCGCCGGAGGCCGACTGGAAGAATTTCAGGTCGACATCGTCGCCGTCGCTTAGGGAGTTGCTTTTTTGCTGCGTGGGAAAGAGGATTTCGTCCATTTAAATGAAATTTGAAAAGCACCAGCGAATAATAAACAAAATCAACCAGGGATGGAGTTGCACCATATTCGCTTTTTGCAACACTCAAAAGTTCCGCACCACATAATAGATGAATATAATTCAAAATATCGGATTAAATATATTAAAGGTATATCATAGTTGTTTATAAGGTGGCTTTGAGATTTTAATAAATAATAAATATATAAATATACAATATTCGATAAACTTTTATTTTTGTAGTGTTTTTTTTTTCTTCAAATTAGTGCTCAAAGTCAAATTATGTAAATTTCAAATTGAACATTCACTGGTTCCGATAGTCCACAGCACGTTTTACAGCACTGGCCTCTGACACCTCGTGTTTTTGTTCTTTTCTCCGCATCGCCATCGCCAGGCAAGAGTGCGCGCTACATTTTCGTTTATTTCATCGTTCAGCCAGCAACCAAGGCACTGCGAAATGTCTGCAACCGAGACTCTGAATGTGGAGGCGGCAACGCCCGAGATCGGCGAGGAGGTCAAGAAACAAAAGAAGCCCAAGCCGAACAACAAGAAGCTCCG CGAGCAGTGCACTGTGGTAATTGCATTTGCACGACCCTCTCCGCCTCAACCACCCACCACCCACTGAACTAACCACTTGCCCACAGAAGCGGCAGCCAAAATAGCCTCCGGAGAAGGCGGCGACGAGGAGCTGACCACAAACGGAGATGCCAAACCGGCAACACCGGCCGCTCAGCCGGCAAAGAAGAAGGGGAACAAGGGCAAGAAAAGCGGTCAGACTGATCCGCCCACCATACCCATTGCTAAGCTTTATCCGGACGGCAACTTCCCCGAGGGCGAGATCGTGGAGCACCCCACGCCCAAGGATATGCCCGACGATCGTACGGCCAAGGACCGATTCACATCGGAGGAGAAGCGTGCTCTGGACCGTATCAACACGGACATCTACCAGGAATTGCGCCAGGCGGCTGAGGCCCATCGTCAGACGCGTCAGTATATGCAGCGCTACATTAAGCCGGGCATGACCATGATCCAAATCTGCGAGGAGCTGGAGAACACTGCTCGGCGCCTGATCGGCGAAAATGGTCTGGAGGCTGGTTTG


Search Again