CR00829

CRIMIC CR00829

Gene CG34174

CG34174

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK79306

Images

Construct Sequences

sgRNA sequence
AGGGGCTGCTTTCGACAAAGAGG

Amplicon 5' Amplicon 3'
ATTCAAGTGGCGTCCAGGTTAACATATTTTTGAATTTGGCTTTAGCAGTGATCTGATTGAAAATTCACAGGAAAATGAAGGATTTCTACACACAATTACCGGCACTTTTGACGAGCTTTACTTTTTTCTGAATGTGGTGTGTGAACATTGATTTGGTCGAAACATATCGATTATAAGCTTTTCAATTGTGTGTATTAAAGCAATTGATTCATGTAATCGATTAAGATTAAATGAAATAAATGTCGAAATGTCCATTCCCCATTTAAATAGCTATAGTTCTATGCTAACATTGAATATATTCACTTATCGATATTAGAAACCATTAGTGTTGATAAACGCGTTGAACGTATTTCCCAAAGAGGAGGTGTGCATACACTAGCTGAAGTAAACAATATTGTTTACAAAATGACCAAAGCGAATAAAACGCCGCAAAAAGCAAGTGAACCGAATATAAATGGTTCCTTCACACCAGTTCGATGTAAGTTGGCTCCAAAGACAAAAAAGGTTATTATTTCTTTGCATCGTTTCCAGATTTGGACAGCCAGCGCCTGCAATCGCCCACGAGTCACGATGCGAATTTAGCCACCTGCAAAACCAGATTGGAAACAATAGTCAAACAACTCCAGGATAACTACGCTAAATGGCAGCTGGCCCATCAGCGGGGCACCTCTATTTGCTATACTATCGAAGCCAAGAAGACCAAGTGTCTGGAGAAAAGCCAGGATGAAGGCAGCTCCCTTTACCCAGATGATCTCCTACTTCCCTGCAACAAGTTGGCCATCATAGCCTCTATTTTCGGGGATATCGCAAATAATACAAAGGAGATACTAAGACAACTGAGAGGCATATTAAAATTACCGGGATCTGCAGCGGATACGATATTCTACAGGTCCTGGAAGTTGCAGCAATTCGTGGTTTTCGCGAAGGAGCTATCCGAAAGATATGAGAAGGAGGCTCTGGTCAAAATGGAAGTTGCCGGTAGGAA TGTCGAAAGCAGCCCCTTTAATACGTTTGAAAATTCAAAGAAGCACAGATTAATTTCTCAAATTCGATTTACCATCTTAAATATAATCATGTTACTTTTCTTATAGGTAACATTGCTCACTCGACTGAAAGAAGCCAGCTCATTGCGCACACAACTTTATGGGAATTTCCCGAGCACGTGGACTCCTATGTCCATCTGGGGTTTCTTCTCCTTGCCGAAGAAGTCAGTTTAAGGCAATAAATTAAACAATTTTTCAACTTAATACAACATATGGTTTCTATCAAATGTTCATGTTGGGCAGTAAAACTTCATTACAGCTTTAGATTAAGCGAATGCTTAAAGAAGTAATAAGTAAATTCTATAAACTTAGGTCCTATGAGAAAATCGGAATGTAACTATTAAATGCATCGTTGTGCGTTTTTTTTAAGTCTGAACGGAGATCCGCTCCAGTCGGGGAGCGCTGCGGAACTTGGTCCACCACCAGAACCAGGCGCACGAAAATCCCACAGCCAAGGTGGTGTAATACAAAATAGTAGCCAGGCTCCACTTCTTCTGCAATGCAAATTTGTATAAAGGAAAATAATTTCTTATTGCTTGCTATATTCACCTTCTTGTGACTCTCGTTGCCCTGCACTTTCTTCTGGCTCCTTGCGTTCTGGGCATTAGCTTCGATTTTCGCGAGATCCTTGGCAATCTCTTCGGTGATCTGATTCACGCTTTTTAGAGTTTCCTGGGCAAAGCAGCTGGCATATCGTTTGTCGCCCAC


Search Again