CR00828

CRIMIC CR00828

Gene CG10413

CG10413

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK79305

Images

Construct Sequences

sgRNA sequence
GGATTCGTTACGCTCTGCTTTGG

Amplicon 5' Amplicon 3'
ACGTGTGTCCAATTCCACCAAAGTAAACCCTGACCAAATATTTATAAAAAGCCCGATTTGATCCCAAGATAGACTAGATATCAGTATCACATTTAAATTGATAAGACCAACAGGGCTTTTCCTCAATGAGCAATAGCTACACAGCAAAAAAGGTAATTTCATACTATATCACATAATCATTTAAAGTTTGTTAAAATATGTAAGGTCTATGAAAAATGTAGCAGTAGTAGCCCTAATTTTTTGTATACTATTCAATTTTTTAAATACAATATTTTTAAAGAGTGCAACAAAATCTTATCAATACATGGAAACATAAGACTTTTCCCCGATGTACTAAAAGATATCTTACCGTGTTATTGGTGGCGCCCACAAATAGAAAACTAAAGTAAGTGGCGAACAGGCAAACGGTGACGGTGGCCAAAATAATCACTGACGTCTTGGCGAACAGAGCGGCGCCCACCAGGCAAACCAGCAGTTGCAGGGTGTTTATCATGCTGCTGGTAAGGAAACGCCACCAATCCCCATCCGGTAGGTGGGAGTCCCCGCTCACAAAATGGCCACGCGGTCCGAAGTTATCCATGATGCCCTCAGTGCAGCCGGATATGGCCATTGCAGATCCCACCACATTGGCAAAGAAAAAGAGGGTTCCGATCGAGCCACCAAACTCCAGTCCCAGCGTTCGACTAATCATGACTGCAAAAAAGTGTGATAAAATAAATGATTTAATGAATGTAAACGAGAAAAACCAAAGCAGAGCGTAACGAATCCG GAGCGTAACGAATCCGCCTATTTTCGAAGTATTTCATAGTCAGAGATACTAAATAAGTAATATCGATTACCATATAAAATATTTGACAAGTCGTTGGCTTAAAAACATGCAGTTTTGCATGCATTTTTATTGTTTGTAAGACATACAAAATATATTAAAATGTAACTTTGTGGTTACTTTCAATAAATGTACATATGTATATACAAATGTATATAGATTAGAAAGTAATTTAATTATTGAAAACAAAGTAACAGATTAAATAATAAAATATGTATATATGAGAATTAAAAAGTATTTACGCGCTAATTAGTTAGTTACTCACAATAAACTCCCCCTCCCTCGATGGCTCCATTGGTGGAAATGGCGCAGACCGAAGCCACCGTGAAGAGCAGAATTCCGTAGGCGATGAGGAACTGCAGCAGGGTTACATACAGGCCCGCATTTCCGACGATGTACCCTGAACAAAGAGAGTTAAATAGTGGAAAAGACCGAGATCAACGGACCATCACAACAAGTGTTTTGTGACGTCATCGCCGCGCACTTACCGACTCGAATGAAGACCAAAGCACTAAACATGGACAAAGCCACTGGACTAAAAACTCCGGCAAAGGTACCGAGCGTACGGCCACTACGATCCGGGTCCTGCATTCCGAACTCCACATATCCGTCGCC


Search Again