CR00827

CRIMIC CR00827

Gene mRpL13

CG10603

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK79304

Images

Construct Sequences

sgRNA sequence
GCGCAACTGAATGACGGTTCAGG

Amplicon 5' Amplicon 3'
TTGCAGGGTTGTCGAGGATCGCAAAGTGTTAGACACAACAATCTATTAATTATGAAATAAATTAAGCAGCTTGCCAAACTAAATACGTTATTTCCAGTGCCAAGTTACTTTCTTTAAATTCTTGCTATTCTGACATAAATTGTAAAGTCTATAAAAATTAACCTGAAGCTTAGCTGCCTGGCATCCCTTTTGCAGTATTGCCAGCCCAAAAAAATCTCACGCTTTTAGATTAGTGAAGTCGCCGCCGTTATACCATGTAATAAACAATAAAATCACATAAAATTTGGCTATAGAAAATAAGAATTGAAAAAAAAAAATTAAAACTTCAATAAGCTTTTTCCATATTTTGTATTTATCTTAATTACAATGATTTCCTATCAGCATATCAACGCAAGATATAATCCTTGGGATAATCCATAATGTTGGGGAAGTTCTCCAGCGTTTCTTTGTCGATATGATCCAGACGCTGGGGAATAGAGCGCGGCGTGCGGATTTGATTCGTGACGTTTTGCAGGATTTCCTCGGGCACCTGATCGTCGGCGAACAAGTGCAGTCTTTGCATGGTGTGCCTGCGCTGCAGATTTCCGCGCATCGAGTTGTACACGGCCTTCTTCATCACCATCGTGGGATCCTTCTCGTGCAGCTGCCACGCCAGGGTCCACGAAGCGCCACCAGGATAGCCGGTGTGGTGGAAGTAAACCCTCTTCACCCACTCGTCACCGGGCAAAGCGATTTCCCGCGTGTTGATCAGCACCACATGATCCCCGCAGTCATCTGGAAAATTACATGTACGGTTTTTATTGGATGGCCGTTGGGGATTACTTGCTTAACCTAAAAGTACAATAATCACTGGTCAAAAATAAGGTATGAAATACCTGAACCGTCATTCAGTTGCGC GTCATTCAGTTGCGCTCCAAATAGTAGTTTTAGTCTTAGCAGAGGAAGTAACTATATATAATCGGCGACCATTTAGTAGATCCTTATGAGTATGAGGATTTTTAATTAAACATATTTGTTTAAGGATTAAACAAACAAGGATTATTACCGAATTCATACTACTATTTGAATCGCAGGCTGAATGGTCAAATAATTACCGTTTTTGGATTAAAATTTATTTGTTTTCATTTTATACTTGCAGCAGCAACAACAACAACAACAACAACAACTAAGAAAACACGCCGGTGATGTAATGACATCGAAATACCCCAAAAAAGGGCTTAAATCAAACGCTGTCGAGATCGAAACTAAACAAAAACTGCGCCAAAGGATAACACTTACTCATTGGGTGGTAAATGGGCTTTTGGAGGCCCAATAAATGCGTTTTAACCAGTTTTGCCGACTCGAATGGATTCTGCCAGGTGCAATCGTAAATGTGCCAAGTGCGCGCGAACGTTGCCCATTGCTAAATCCGGAGGAAATTTAATGATTACCTATTGCACATTGAGGGTAGTGAGCTTACGCACCTGCACACGCTTCGCAATGGACATTTTTTGAGATTTTTAATTAAACAATTTAAATAAAAATAATTTCTCAGCTGGCAGACAGTG


Search Again