CR00826

CRIMIC CR00826

Gene Kua

CG10723

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK79303

Images

Construct Sequences

sgRNA sequence
AAAGCAGCAAGAGAGCGACATGG

Amplicon 5' Amplicon 3'
GCCCATCGCGTTTATCAACCTACCCAAAAAAAAAAGGAGCTAGATAGCCTTCACAACAATTTAAATACCAATTTGCCTAATTAAGGCAACTCTAGACCGCGCCTCCGCCCGTGACAACTCAACTCAACTTAGCTTCTGGTGGTCCCCGCAGACCAGGCGTAAGTCCAAAATATTGCGTGACCAGTCGTTTGGGTGCTAAAAGGGGTGGGGATTCGGTGCAGCTGGAGGTAATGACATCAACGAACGTCGCAACATGCTGGGATCCCTGACCAGAGGTCATCGGTTGGAGCTACGCGACGGTGTGTCCCTTGGTTGCGCTCCAGCCAAGGCGGTTTGGTTTCGAAAACATTTTAATGATTTAAATATATAGATATACAATATATATTTGATGCCCACGTGGCTGGCCTCGCAGTCATCAATTATGTAGGGGCGACGAATTGATCCAGATGCCATTATTCACAGGCAATCAAATCCTGTGGCCTGACATTGAATTCAGCCATTGCATTGAATTCAATCAGTCAGGAACGGTCATCAAGGCCTCCCAGTTGTTTTCTCCGCTCGACTCCTGTTCTAAACTCCTTCATCCGCAGACGATGGCGGCCAAGAGCGATATGGATATTCTGGCCAACTCCATGTACGAGGACGATCCCAATGGCAACCTAGCGCCCGCCACCACCAAGGATAAGGAATCAGTCAAGCCGGAGGAGCTGAAGGTCACCCCCGCTGGCACCAAAGCAACATCCCCCCCCAACTCGGCGACCTTAGTTTCGACTTCTCCGCGATGGGGTCCGCAGAATAAGGGCGCCCAGGAACTAGCCTTGTTGTACAGTCCAGGTGAGCAGTTCCCACGGATTATAAGCTGTTATGAGAAAGTTACCAGAAGGTGAACTAGAAAGTTTCTTGTCCGATAATTACAAAAGAAGCAAACTGCTTTAAGATAATGTCCGATTATATATCAATCAAATACTTGCCTTGAATGTCCTATACAACATATATGTATGTACATAAAGAGCGCACTTGTATATTATTACTTGTATATCTCACGTCTTTTGCCTAAGCAGTGGGTATACGATAGCGAGGCAATCATATATATTGGCTTCTGCAAAAAGTATACAACAGTCTGTACGTTAAGAGTGCAATCTCTGAAATCTCAGTTTGCATATTTCCATGTCGC CTGCTTTACCTCAGCAATGGGTATATGACAGTCGAGACACTAGATTACATTAGAAAATCCTGGGGTTTTATTTTATTTAAAATTTTATTTAAACAGGAAAACGTGCCCAGGAAATCATTTGCGTCTACACCTGCATTGGCCTTATGATCATTAACCTAGCCCTGATTGTTAGACACTTGCGATTGGAGCGGATTAGTGTCGCCTTTCTGTCCGCCCTGTGCGGCATTATAACGGCCGACTTTGCTTCCGGCTTGGTTCACTGGGCGGCAGACACCTGGGGATCGGTGGACATACCGATGATTGGAAAGGTAAGCCAAATGTACATCGAGAATCTAATGTGATAAATGATACAAGACATATATTTTGAACTCTTCTAGAACTTCCTGCGACCCTTTCGCGAGCATCATCTGGATCCCACATCCATAACGCGACACGATTTCATTGAGACAAATGGCGACAACTTTATGGTTGGCATACCAATTCTCGGCTACTTGGCCCACTATTTTTACATCAGGACGCCCAGCGAGATACAGCAACACTTCGGCTGGATAGCCTATGTGTTCCTCTGCTCCATATTCGTGGCC


Search Again