CR00825

CRIMIC CR00825

Gene CG5174

CG5174

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK79302

Images

Construct Sequences

sgRNA sequence
GAAGTTAGTCTGGTTAGTCATGG

Amplicon 5' Amplicon 3'
GTAGACGAGCGTGGATGGAGCAGGCCCAGAATCGAAAGCGAAAACGAAACTGAAATCGAAACAGAAACAGAAGAACCACCACAAACCAGCTGCGATCGCATGGGGAGAGGAATTTATGTGGAACGCGGCGGGCCAAGAACTGAAAGCTCAGCAAAGAACGATCGAAGTGGCTGAAAGCAGGGCCAAGAAAAATGTGCTCGCTGCTGACCGTGGAAACGTGATATGTGCTTAGGATTGGGCCAAGACAATATGAGCCTCCTGCGCCAGCAGCTGCCACGTTCAAAATAGAAAGTTGCTGCCAAAGATGAAAGAGAGCGCCGCTATTGCCACAGAATGAGCGAATCGGAACCGAATAGCCTGGAGTTCATTGAAGACCCCTATCTGCCAAGCATTGATGATCTCACCAGCACACCGTCACTGGATCTGGAAACCAATGATGCCGTCTTGGACTGGTATGGCGATGGGCAGGAGGAGAGCGAGGCTGAGCTATATTTGCGTAATCTGACGCTAGACCAGATATTCTACGATGTGGATTCGGACTACACCAACAGCCTGGAATTGCAGGCAGTGGAGGCGGACTTCATTGCCGCCAAGTTGGCCAATCAAGCGCCATCGTCTTCGATGGCCAAACGCTTCCGCTTGAAGTTCTTTGCCAAGCGAACCATGCGCGACGTTAAGGTCACGTTCATAGACTTCTCCAAACCGTATCTGGCCAAAATATCAAACAGTGATAACTACAAGAGATTCCTCAACATTGGGCATAGAAGTAGAGGTACCAAATTCGGTCAGTGGGGAGGGGGGTTGGTGGGCTTAGGTCGGGTCTTTGTTCTGTGGCATTCGCTTTTCCACTTTCAACCA CTGTTTCTTTCTCCTTTGCCTGCCTTTCGCCTCGTCAGTTTGTGAGTATTAACAAAAACCCAGATCTAACCAATTAACCAACTCATGTCTTTGCAAATTGTACATACTCGTATATACAACTAAATTCGGTGTATTCAGCCTATGACAAAGTCTTTGAGGAAGTTGCTTTCAAAGGAGGTACTTAAACACTACCCGCCGACAACATTGAAATTAAGCTACAGTCCCCACACAGCACCCCAAGTTTTAATGTTCCCTTGGATTGGCATATATTTAATGGCTTTTTATTTCATGTTCAGATAATACAGCCAACCTGTCGGAGCCAGCATCTCCAGCTAATTCTGTGGCATCCGCAGAAATTGCCGCCGAGTTCGCTGCGCTTTCCGTCGAGGAGAAGGAGCAGCGTCGGGCTGAGTGGAGTCAGGTAAGGAAGTTTTCAGTTTTACGATCATAATTTGATTACTCAGCTCGAACGCTAACTTCTACTTCAATTTCCAGGAGCTCGCCCGCGTTGAGGAAGAGATCAATACGCTGCGAACTGTCCTAGCCTCCAAGACGCGCCATGCCTCCGATCTCAAGCGCAAGCTGGGCATCACCGTCTGGAAGGAGGTGACGGACGACGTGAACCAGGGCCTTAA


Search Again