CR00823

CRIMIC CR00823

Gene Asph

CG8421

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 no band OK80677

Images

Construct Sequences

sgRNA sequence
ATAAGACGGCGCCGGTTGGGGGG

Amplicon 5' Amplicon 3'
AAAACGCGGTAAGTCCCTGTTACGGTACTTTTACTTACAATCATACTCGAATGGACCGTTATTTGGTGTGAAAAACGGTTTTGTCTTTTCGCCGCCGCCGCGTAGCAAGCAGTTCATTTCTTTTATTAGCATAATAATATTGTCGAGTGCCTTTAAAAATAACTTTGCCCTATTATATAAAATTATACATCTCGCCTGTTTTCTGTCGCTATGCGTGTGCCGATCGAGCAGGAAAATATATATGCATGACATGTGTGCGGGCGAGGAAGGCGGGAGGTAGACCATAAAGTGGGTATTTCGATCGGTAGCCAAAGAAAAAGGGCATTGAATCGGTGTGCAAAAATCGAGAAAAATCAGAGAGAGTGGTTTTCCCTGATTTATTTATCTTTTTCCCAAGGCAAACAGATGTTTCGTTGTCCCTGGGGTATCCTCTTATTGCTATCTCTCTCTGCCACTTTTTCTCTCTATTGCTCTCTTCTCTGCGTTATCTTTATCTCATTGGAGAATGGAGAGCTCCGTCACCTTCTCGGCAAATTAATTCCAATGCAACAGAGATCGAGATTTACATACACAGATACTACAATAGATACCAGATAATGATGCTTCCGTAAAGATTCTGGGGCCATTACACCCACGGCACCGAAATAAGTAGCCACGATGGTGCATATATGTGTAAAGCCATTTAATTTCACTTGGCCAACTGCCCAAGAGCATGACTGGGCGGCTTCTTTGTTTATCGTTGCGCATATTTAGGCATAAACAATTCCCCCCAACCGGCGCCGTCTTATCAGCTT GCGCCGTCTTATCAGCTTGTAATGCCGGTATATGTCTCATTGTAACTAACTTTTCGTCTAGATGATCGCAAGTCCGAGGGCGATGTGACTGTTCTGCGTCAGTCCAGTTTTCAAGGTAGAGAAATAGATACCCCCCTATATGTATTTTTCCCAACACACCCCGGAATGCTTTGCCAAATTAATTGAATGTCTCGCTCAGTTACTAAAACCAAGTAAAACACTCGAAGGTGGATTCAATTAAACTGCTTGTAATCACATGTGTTTTTTTATTATTCACTATCATGCAAATGTCGGATCTCAGATGACGACGAATCTTCGCACGGCGTTCACATTACAAAGATGGGAAACGAAGATCTCCACCTGCATGTGCACCACGATCACGGAACTGGCGGTCACTGGTGCGCCAAGATTATATTCTTCGCCCTGATGGCAGTGCTCCTCGGTTTGGTGGGTCTGATCATCATGGAGAATCGCGGACTGGAGGATCGTAAGTTATAGAATTCTTAGAAATTTGAATTGTACTGAATACCTGTTTTATTTTAGTGGACACTCCTCTGTCGGAGTCTAGGTTCTCGAAAGTTTTTGATGGCTGGGTGGACGAACATCGAGATGAGCATGATGGTCACGATGTGC


Search Again