CR00821

CRIMIC CR00821

Gene Socs36E

CG15154

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK79301

Images

Construct Sequences

sgRNA sequence
GGTCGGATTCTCTTCTATATTGG

Amplicon 5' Amplicon 3'
CCTGAACTTGTGACCGCTCTGCTCGATGCGAGCGTGCAGTGACCTGCCGTACTTCCGGAATGTGACCGAGAAGAGGAACTCCTCCTGGGCGGAGTCGCGCAGCAGGAACGTGCCCTCCGGCTTGCCCTCGAGCAGGTGCTCCGCCTCGTAGCGGTCCATCTTGCCCCAGTAGAAGCTGCTGTTCGTGATCTTCTCGAGATCGGGAACCAGGCAGTGCATGAAGTCGATTTGCGAGTGCACGGTCATGTTGCGGGCGGCTCCGATTCCGGCATGGCCAGCCCCTCCGGCGGGGGCGACCGTGGCCAGGGGACGTGGCCGGGGCGGAGTCTGGGGCGACTGGGGGGCGGGCTCGGTGACCACAGTTACGCGGCCGCCATTGGGCGACTCGACCACGAAGCCCGGCGATGTGATCCGAATGATGAGCTGATGATGGTGATGGCTGGCGTCCGGAACGGCGACGGAATTTCGTATCCTTTGGCTCTGCATCCGGCGCTGTGAGCCACCACTCGATGTGCCCAGCGTGGGCGGTGTGGAGCGGCGGTCAGCTGTCCGGGATTTCCTCGGAACCATCGCCACCACCGCAGCGGCATCCTTTTTATTGCTCACGGAACTGCTGCTGCTCGGCAGCATATCCCTTAATCCTCGGATGGCGTCGCGGCACTTGCACTTGCAGCATCGTCGCTTCGAGGATGTGGATGTGGACACGGATGTGGATGCGGATCCGGAGGCGGAGGATGTTGCTGCTCCCATTGAAAGTGCTTTACTGCTGCGACTGCGGCAGCAACTGTTGCTATTATTGCTTCTGGAAACTGTTTTTTCGGAGAACAAAATTTATTATTAATTTGATTCACTTTAAATTTGATGAGATTAGGTCGGATTCTCT TATTGGTCAGCTGTGCACAGCGAAAAATCCCTTGATCATACTATACATTTCGTCGAATTCATTGAACTGAACAGAAAGTGGCATTTCCAACGTTTCACTTTCATGAAATTTTTTGGTGAGTAATTCGAAATTATTATGGTTCTGTTCTGAATTCTAGGCAGTAGTTAGATTGTTTTGATTAGCTTTTACTCACTTTAAAAAGTTCATGATGTCACTACTTGATTGGATTTCATCACTTGGTTAAATTTTTGAAATCACACAACTGAATCTTAATTGCTGACAAATTGGATTTAAATATTATTCACTTATTATATGTTTTGATTCGTTAAAAAAAAAAATCGTGCCGATTTTTCGCTGTGCACTTTCCAAATTGAGAAGAGAGTTCGCTCGCTCTCACACTCCGACTTTTGCCCACCTGGCTTGCTGCTGTGTTGCGTTCCCGCCGACAACATATTGCTGACTGGCAGCGACTCGAGCACTTCGCAATACTCGACGACTTCGGCCTCGTGCTGCTGCTGCTGCTGCTGCTGGTGGTGGTGGTGGTGGTGGTGGATGTTGCTGCGGCTGTTGCTGTTGCTGCGACGCCGACGCAACAGCGACTCATCCAGGTCGTCATCGTCGTCGGCTTCCAAGGGGCAGTTGGCGTTGCCGCCATGGTTGTCGTGCAGTTGTAACGTACTTATCGCAGCGCCGACGCTTCCCGCTAAACCGTTGTTATTCACGGGCTGTCGTTCGGTTTTGGCCGCTTCCGGCGAACTGCCAGCAGTTCGATTTGTCACCACGCC


Search Again