CR00820

CRIMIC CR00820

Gene CG12325

CG12325

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK79300

Images

Construct Sequences

sgRNA sequence
CCAAGGTAAGAGCTGGGGCGAGG

Amplicon 5' Amplicon 3'
ATGGAGAGTGCATACTGGCGGCTGGAAAGTCTGCAAACATATGCATTTACCATGTTAGGGAGGCAATACTTTTGAAGAAATTTGAGATCACACAAAACCACAGCTTAGATGGCCTTAATGTGAGTAATCAAAGAAATTTTGTACAAATATCCTTGTATTCACTGTATATTTTGTTCACAGGACTTTATCAGTCGAAAACATTTAAGTGAATTTGGCAACATGGCTCTTGTGGAAGAACGAGAAGAGCTGGAGGGCGGCAGGGTGGCTATTCGATTGCCGGGCGTACAACGGGGAGACATGTCATCCAGGAGATTCCAGCAAGAGGTTAGGGTGTTCTCCGTAAAGTTCTCACCCACAGGCCAGGCATTTGCGGCTGCTGGCACTGAAGGACTATGCATATACGCCTTAGATAAGGGTAGGCTCTACTAGTATTTATTATGATTACCATATATATATTGACTCTACGCATTTCTGTTCAGGTGTTGTCTTCGATCCCTTTGATCTCTCGCTGGAAGTTACGCCGAAAGCGGTCCACGAGTCCCTCAAGCAGCAGAATTACACCAAGGCGTTGGTCATGTCCCTCAAGCTAAACGAGCCCAATTTGATTGCCCTAGTGCTGGAGCGAGTGCCGTATAAGGACGGTGAGTAAAATGCTAAATCGCCTGCTGCATTCAGGGGCCAGTCCTTGTCAGTTTTGGCAACCTTCATCGCTGCCGCGACTAAAAATAGCGGCGACACACTCCGCCGTAGTGGCGGAGTGGTTCGCCACTTGCCCTGACTCCGTTCTCCGATCGAATGTGCAAATTTGCACTTTTGCTGTGTTAATAAACAGTTTCAAGGTCCTCGCCCCAGCTCTTACCTTGGTT ATAACCCCTTCCAATACCGCTTGCAAACGAACTATAATGGTAGTACATGCAAATGGCTTGCCGTAAACAGCTTTGGCAGCACGTGTCTGTATTGCATGCATATTGAGTCCTTGCTCCTTTCGCTTTTCCAGTCGAACTGGTTTGTGCGGATCTGTCGCCGGAGTTTGCCCAGCGACTGTTGCAACAATTGGCCCGTCAGCTCCAGTCCACGCCACACATAGAGTTCTATCTGCAATGGAGCTGCTGTCTGCTGACCAAACACGGAAACCAAGATGGAGTCTTTCAGCACACGGGCTTGCTGGCACTGCACGAGGTTCTTTCGAGGAAATACGAAATGCTTAACAAAATGTAAGTATACTTTTTTATATTGTGTAAAAGGAGATTTCACTAAGTTCTTTATATATGCAGCTGCGACTACAACAAGTACACGTTGAAAGTACTCCTGGATAGAGCTGATAAGTTGGAGCAGAAAAACGAGGGCAAACCCAATGCGACGGAGGAAGATAGTGATGAGGAAATGCTACTTATCAGGTCGAAGGACGACGAAAATGGACAGGCGCAGTTTAGCGATGAGGAGGAGAGCGACAGCGGATCCGAAGAAGAGATGGCTTGAATCGGAGCATTGCCAACTATTTCCTTGTTATCTAAATCGACGCATACTTTGATTTGATAGATGTACGCGCCTTGTCTT


Search Again