CR00819

CRIMIC CR00819

Gene rho-7

CG8972

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK no band80676

Images

Construct Sequences

sgRNA sequence
TTGCGAAATTACGTACTTCTAGG

Amplicon 5' Amplicon 3'
CGCTGAGGTAGACCGCTAAGAATTGCTCTTTACCCAACGATACAGCCGCAGCGTTGGCAAAGCTGTGCATCACGTACATATTGGCGAAAAGGTGCATAGCCGAGTAATGGCTGAATGTGGACAGGAACATGGGCCAGCAGACGACTTCTGCGAGAAGGGTATCAAACACAATTAGTTAGGGGGGTTGTAAAAAACAAATATCATAAAATACTACAAAGTAAAAAATAGTTTATAAGTCCAAAACTTTTTGAACTTAACATTTGAACATTTGTTATTCAGGTAAAACCAAAAGTTTACATAAAAAAGATGGAAAATAACAAGCTGACATAACTAGAAGAAATTCGACCACTTTCTTATATAACCATAAATAACATGGATTTCCGGTCGACTACTATTCGTCTAATACTTTTCACGTGTAATGTATTTAATTATTTTTTTAGGCGATTTTAATAATTGAATGCATCTTATCTGATACATTGCGATAATGGCCAAAAAATGCATAACCAAGATAACTTTATACTTCTATTTTTTGTGATTAAAAAGGCAATCAAATCCATTTTGGCATACTGCCTAGAAGTACGT GCAAGATCTGGGCGTTGTGATATCACTTTTTCGGTTTCATATTGGATTTTAGCACTTACTCGCCGCTGGATTGGATGTGAAGTAGGTAATCATTGTGGATTTCAGAGCGGGCACCCGCCACATGGCGAAGGCCACCAAATTGCAGAGTAAGATAGGAGCAAACATCTTGTCGCCGGGTGTCAGTGAGTCCCAGTGCCGCCGGATGTCTTGTTTGATCTGTGTCCAGTAATCCCTGTCCGCCAGCGAACGACTCTGCCACCAACCGAATCTCGCCTGGCGAGCCTTTTCTAGGATTAGGCTACGTGTGTTCTCGTACTCCAGGATGGTGGCACCCGCAAAGCAGCCGACCGTAAACTACAAGCGTGAATCAGGGACTATATGAGATCCCCGTACAAGTGCTGGTCATGATTAAATCTTACTGCTCCCGTGAAGGCCACCGCCTTGATCACATTGTTCACCGGCACCGGGGTGTTCTGCTCCGCTGCCGCAGGCTCCCCAGTCGTCGGCTTCAGGTTGCTGCTCTGTTTTCGGTTGCTGTGAATCTGCCGACATGACCTCGCCGCCGGATGACCAGAGTTTATCCGCAGGATTGGCACATTCACATTAGCATGACATCTGCGGCTGTAAGTTTACGTGGGGTTACTCCGGAT


Search Again