CR00818

CRIMIC CR00818

Gene CG13096

CG13096

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK79299

Images

Construct Sequences

sgRNA sequence
CCTGCTAATGAGTGGGTTCCAGG

Amplicon 5' Amplicon 3'
CTGGAGCTGCTTGATCACCAGCAGAATGTTCTCAGCCAACTGCTCGGCGGTGATTTCGTGGTTGCCCACCGGAACGGCAATTAGATCTCCCTTTGACAACTGCCTGAATGCGGTGCGGGTGAGGGCGCGGGTCACCTCCTGTGGCAGCTTATCGTTGTCCTTGCTCAGACGCAGTGAGTGGAGCACGTTGCGGGGCTTCTGGGTGTTCTACAAATGGATAAGGCAGTGGTATTGCAAATTTAGAAAATAGTTAATAAATTCTATTAAAGTTCTTCCTAGATTTCTATAAAATCCGCGTAATTCATATGGCTGAATAAAAATACAGTCTCCCGATTTGAAAAATGTTTTACAATTTGGAAGAGAATAACATTTAATATGGCTGGATTAATCTCATTTCATCATAAAACATTGCGAAGGATACCCTGATTCAGAATATATATGAATACCTTAAAAAAATACATACGAATGTTCGCGACCTTCCCACAAGATCTATTTGCGGACAAAAGAAAGATTTGTCTTCCTGGAACCCACTC ACCCACTCATTAGCAGGCAGAATTTCTTACCTTGCCCAAAAAGGCAGTAGCCTGTCCTGACAAACGACCGTCGCACAACAGGTAGTCGTAGCTGTTGAGGAACTTGCGCTTGGCCTCAAAGGAACCCATCTCGTTGCGCAGCTGGTTGAATGGAACGACGGTTAGGCGCTGTTTCACACCAGCCTCTCGCAACATATCCTCGTAGTGTTGCTTGGTGGGATCATAGTCAAACTTGGCTCCACGCTGCAAATCTGGCACGATGAGAGCCACATCGTCGTCCTTGCCCACCAACGAATGCTTCAGATTCAACTTGACCATGCGCTTTGGGCAGCTGGGGATCTTGTAGCTGCAAACTTGCAAAACATAGCGGTAATCAGAGAAGATCGAGGTGTTCTTCTTCTTTTCCACCTCCTCGGAGACAACAGACTTCAATGCCGCGCACACCTTCGTCACATTATTTTCATTGACAATCTCGTGGAACCGTTTCTCGTCAAAGGCCTTCAATTCGAAGGTCAGCTCAACTGGTTTTTTAGACTTGGCAGGCTCTTTGTTGACAGCGTTGCCTTTGGCCTGACCAGGCTTGGACTTGCTGAGGGCCTTCTTGGATTTGGGTGGACTGGCAGGCTTAGACAG


Search Again