CR00816

CRIMIC CR00816

Gene CG8399

CG8399

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK79298

Images

Construct Sequences

sgRNA sequence
ACTTCGGGGTCACATGAGAGGGG

Amplicon 5' Amplicon 3'
CCTTCATGATTGCCGCATGGATTGGAACCACCTCGCTGGGCATCATCTTTGCGCGCTACTTCAAGCAGACGTGGGTGGGCAGCCAGAGCTGCGGCACGGATCAATGGTTCGCCTGGCATCGCCTCCTCATGGTCACCACCTGGTCGCTTACGGTGGCCGCTTACGTACTCATCTGGGTGGAGCTGAAGCAGGCTGTGTGGCATGCCCATTCGATAATCGGTCTGATCACGGTGATATTGTGCTTCATTCAACCCATTGGAGCTCTGTTCCGACCGGGACCCAATGACAAGAAGCGGCCATACTTCAACTGGGGTCATTGGCTGGGCGGTAACCTGGCCCATATTCTGGGAAGTGAGTTCAGCGGTCGTAGATCATCCAAATATATGGCTTATTCACGAATCTTCTTGCAGTTGTTACCATCTTCTTTTCTGTAAAACTACCAAAGGCCGAGCTGCCCGAGTGGATGGACTGGATCCTGGTCAGCTTCGTGGTGGTGCATGTACTCGTCCACCTGATATTCTCCGTAAGTAATTCATACTGCAGTGGTTGGGTGTTTCTCCCCTCTCATGTGACCCCGAAG CATGTGACCCCGAAGTGTACAAAGATTAGACCCAGCATCGCCTGCCTGCCTGTACAGTGGTTCTAGTTGTGTCCCTAAACGTTCATTCATTCCATACTAATTCATCTGTCACCCATCATCCGCTCGAGAACTGGTGGCTATGTCCCTTAATGTGTAGATCGGCTTGTGTTTGAATCATTGGCAGATTGGCGGCATGGCCTCGGAGCGTCATCTCAGCCAGCGGGCGAACACTTTCCAAATGGGCGACATGTCCCATCATCAGCAGCACGCCATGCGGAATGGCATGAGCATGGAGCGGAAGATGGATGCCCCGGTAAGTAGTAGTAACCTATATTGTCCATATTCTTCATCCTGTAACTTCCCAATTTCAGTATGCGGGCATGCGCAAGGGATTGCTCGGAGTTTACGGCGTGGTGCTGATTCTCTTCGTGACGGTGCTGATCCTGTTGGTGGTGCTGGCGCCCATCGAACAATTCCTGGGAAAGTCCTAGGCCCCCTAATTCGGATGTCCTGTAACCTGTCCCCTTCCAATACTCGTGTCAGTTTTGTGTGCTCATTGTTTAACCCCTTCCGCCCACGGCTCTGCCCTGCCCACCACCCAAATTCCCATCCTTTTTCCATTCAGCTTTGTGTTGTTAAGTGTAATTAGGCGCATGTGTAACCTGGGGCGGAGCGTTCAGTACATGTTATATAATTTATTATTAATAAAATAAAACAAGCCAACATAAATGCAGTACTTTCTTTCTCTTCTTTGCTGCTATGCTCAATTTTAATCTGCTGCGCTACATGCATATATGTTTTACCGGTAGTATCTGGTGCTGGTGAGTGCTGATCGATCGGATTGCGTTGGATTATTCTATGTTTAGTATGGATTTGTATAAAACCTTGCAGCTAGAAATTATCATTATCTTTAGATATAGGTATATATGTATGTATGTGGTGTGTATGCTTTCGTTAAAGTGTTGCTGCTTGCTTAATTATAGTACGTAAATTATAGGTAGATCTACAATTTTCAGATATTAATGCAAAAACTAAACCCAATCGAACGAAACGGCCTTAAAGTAACAAGCGGAATCATCGCTCCTCCAGGATGACCGTTTCCTGCGGATACAGCTTGAGCGACT


Search Again