CR00815

CRIMIC CR00815

Gene CG9646

CG9646

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK79297

Images

Construct Sequences

sgRNA sequence
ACAAGCATACACATCCTTAGGGG

Amplicon 5' Amplicon 3'
GGGAGTCTCTGCGAATGCTTCTATTTGAGCCACTGGCCACTCCAGAGGGCCAGCTGACGCGATCAATGCTTCGAGAGCTGAAGGAGCTGCAGGATGATATAAAAAATCTTCGGGAATCCGATGACGATGTGGTAAATCAATAAGATCTGCGAGTTTGCAGATTAAAACTGGTATTTGAATTCAATAAGCATTGTTTCCCATGTTTAACTAATGACTTATTCATGTGTATAGCATTCATCTTGTTGATTAAAAATTTGAAAAAAAAAGAGGATACAATATTAACTGAGCTAAATTTCAAATCAAATCAAACCGAAATTGTTAGGAATGTTCACGAACAATAGGAAATAATACTAGTTTGCATTACTTTTTAATGAAACTTTAAATCAATTTAAATTCGATAACTGATATAGAGCTTTAATCGAAGAGCCGCACGTTTGCTGTTATCGTTTAATTTACCGCTTTTGCAACACTACTGAGTTTATTTATTGTTATTTATCTTTTTTTTGCATTAAACAATAAAAGCTCAGCTAGACAAAAGAGTTAACCGTGGAATTTTCGACATTTCCGAATAAATAACACAAAGAGGCAGTGAAATTATGGGAACAGCTGATAACTGATAATACAGATGGGGTATGCACCGCGAATAAGGGATAAAACAACCCCCAAGTGGGAAAAAAACGAGGGTTTGCTGCTCAGTTGCGATTTGCATGTGCCGTGGAGATAAGGTGCTCCTCTGCACCGCTTGATTCTGCGACTGCAAAAAATTTCCAACCGTGGAGCAACAACAAATGCTGCAATATATACATCACTAGCCGCGTCCCCGCAACGTTGCCGCCACCCCCGCAAAGGCCGTAATGTGTTGGACGTTGTGAAATAGTAATACTCACCATTCTACATCGACATTCGTCATCCGGAAGCGCGGAGCCGTGAAAATCCCCCTTTAGGATGGCCCTCGCCAGTGCCGCCGCCGCCCTCTTGAAGGGTTCGCAGACGCCTCTGCAGCAGCTCCTGGAGGACATTAACTTCCAGCGCACCAAGGAGATGCGTCAGCTGCTCAAGGATGGTGGGTACAGCTCTAATCCGGACTCCGCAGCTCCCCGATTCGGTTCAAATAGCAGGGAAAATTTGTCTACATTTGCACTTTATCGATTTATCACAAAGGGCAACCCCTAAGG ATGCTTGTGTGTGTGCCCTGCTGCGCTTGTGTTTGTGTGTTCGTGCCTTTTCCGCCCCACTTTTGGCCAACCTCTTTGTTTTCCTTTACATAAGCGGCTTTTACTTTTATCGGCCCAAATGGCAGTATGGGAAAACCGCAAACAGCTGTTCACCTGTCGGTCAACATCAGCATCCCCCAGTTTCCCACAAGTCCTCAAAATCGAAAAGATAGAGCCGAAGCTAAGGTTCCTAGAAATATGATTGCCAAAACGAAATTCTCAAATTTGAATATACATAGATAGTTAATTATTTTTATGATGCAATTGAAGTTTGGGATTTAATACGTTCCATTTATAGAAGCTTAGCAACGCTTTTGGTCATAATAAATCTATATAACAAATTATGTAATACACTTAGGCATTTGATTTCATAACATTGACGCTGAAGCTCAGAAAGTTAATATTCTTATTATATGTCTCTTAGATGGCGGTTTCGTTGTCCTACAGGGCACCACCTACTGGACGGACCTGTTTGTGCGTCATTTCCTCTTCCAGACAGAGCCCGTGCACAGCATCGACTCAGACGACTTGCTCTTCTTTGTGCGCAAAAAGCACGTGAAGAGCTCCTCTCGTCACATGCCAAAATTTGAGGTGAGCATCAGGAATTACCATAAAACACCCATTGAACATATTCTATTCTTTAAACAGACTGAGGTGGAGGTATTCCGCAAGGACTCGCGCAAACTGCCCATCGGTGATCCTGATGTGGACTGGGAGGAGACGGTTTATCTCAACATGGTCATTCATCAGTTCGATTACACGTTGACACTGGCCATTTGTACAAGGACGTCGCCAAAGGAGTTGCAAGTGCTGAGAAGACATTCGCAGAGGGTCTACGCAAGCCCCAGTCGTCGGAAGATGGACACCAAGGGCGAAGGCGAGGAGATTACGTATCCGCACATCTGCTTCATGGTCGATAATTTCGACGAGGTGTTCAGCGACATTTTGGTGCGCGACGGGGAGATGGTGTGCGTCGAACTGGTGGCTAACGACAAAGATGGAGCAGTGCAAGGAGTGATCTTTTTGGGGTCCATACGCTATGATGCCCTAAAAAAGGTGTACGATGCCAGGG


Search Again