CR00813

CRIMIC CR00813

Gene Rgk2

CG34390

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK80675

Images

Construct Sequences

sgRNA sequence
CACACATAGGTTCCAGCTAGGGG

Amplicon 5' Amplicon 3'
CATGTGGAGCATAAACCGCGACGCCGGGGCAGCTCCAAAGGTGGACTGGCCTACTTGGCCAGCCGGCGAAGTTCCCGTGAGTCGATGAAGAGCGCCTGCTCCAATGCCTCCATCGTTTCCAACGACGATGTTGGACCACTGGCCTTCCAGAGTTCGAATCGCGGTCGCCAGCGTAGAACATCGAACTTTCTCGAGTTGCCAGGTGAGAATGATTTTGTTTTTCATTGTCTGTCTATGATTATTCTTAATTTTCTTTTTTTTCCTCGTCTCAGTTCCCGACCATGTGCGTCCGCGAGTCTGTTCCCTTCCAGAGCGACCGTACAATCCGCGTGCCAGTGATGACCTGTACCGCCTGCGTCACTTCTCCATCAGCAAGGGCAACGTGGTTAACTGTGGCGACTCGATAATCTCGCGGAGATCGCGAAGCAACACCAGCGTCAACTCGACAAACAGCCGGGCCAGCGAACGTTCCCCATTCGAGGGCAGCTGTTGCGGAGCGGGCTATGCCAATGTGGATTCGCTGCCGGCAACACCGGATGACTCGGAGAATTTGGATCCACCTCCGCCCGCCCGCTACCGCGTCGTGATGCTGGGCGATGCCGGCGTGGGCAAGACGGCGCTGGTCAATCAGTTCATGACGTCGGAGTACATGCACACCTATGACGCCAGCCTGGGTAAGTTGTATGCCAAAGTGGGTCCGGGTTATGGTCCGGGTACCTCGGGGACGATCCGCAGAGCGCAGTGAGTAGCCGAGTGACCCCTA TACCTGACCCCTAGCTTCCCGGCTGCCACTGTCGTCTTTAGAGTTTAATTCTGATTTGAGTTTTAGACGACGAGTTCGGCGAGAAGACGGTGAGCGTGCTGCTGGACGATGAGGAGTCGGACATGGTCTTCATCGACCATCCAAGCGTTGAGATGAGCGTGGAGAACTCCCTATCCACATATGAGCCACATGGCTGCGTCGTGGTCTTCTCGGTGGTGGATCGCAGCTCCTTCCGCGTGGCCGAGGAAATCATAAATTACCTGTGGCAGGAGAACTACACCAAGGACAAGGCTGTCATACTGGTGGGCAACAAGGCGGATCTGGCCCGCGCCCGGCTTATCACATCACAGGGTAAGTCCGGGGGGTCTTAATTATGATGGCTTGATTTCATTTCATTATTCCCCAATTCACTCTTGCTTCCCCAAGAGGGCAAAGCGCTGGCCGCCTCACGCGATGCCAAATTTATTGAGACGTCTAGCGGCATACAGCACAACGTCGATGAGCTGCTCGTCGGCATATTGAAGCAGGTGAGTCGGAGGTGAAAAGCTAGGACAAGCGGACCATTGGGGGGCAGAGAGGAAGTGGGGCAGTGGGGCTGCGGTCGTTGGGGCAAGGTGCCAACCACACGCAACCCACCGATGCATGGCGAAATTGTGCAGGAAATGGAGTTAAATGGATTTACCACGCTGCTGCGGGTTGGGTTGGTTTTCGGGTTGGGTTACTGCTTCCGGATCGGCTCACTAATTAATGAAAATGGTGCGGTAAGCGGGACCGAAGGAAACTTGGTCAGCAAACTTGATTAGGTGATTGGGTATTGTTACTTAACTCGGAGTAAGATATTTCCGATACTGGTAGACAAGGTTGTATATAAAAAATAATAAAGGGATGTCTTGATTACACATAAAATACATTTTGACATTTGAAAACTTAATCTAAGGTCTACAAATATTGCTGTTTTGAGGAAGATGCCTTTAAGAATATTTCTTTATACCATTTTTCATTCTTACACTATAAAACAGATGCGGCTGAAAGAGAAGCGGGAGAAAAAGGCCACCGCCTCGAAGATGAAGACTTCCCGCACCCACATATCGCTGCACTTGGCCAAGGAACTGCTGCAGAAGATCTGCCTCAGCGACATCTCCAAGTCGAAGAGCTGCGAGAATCTGCATGTG


Search Again