CR00812

CRIMIC CR00812

Gene yki

CG4005

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK79628

Images

Construct Sequences

sgRNA sequence
CAAAGATACACGGTAAGGGAAGG

Amplicon 5' Amplicon 3'
GAATCGCGTGCATTCTGGTCCAAATGCACGCCGCATTCTGGTTACTTGGTTACTTGGCTTGCACTTTACAATAGTCGGGGTATTCGGGTTTCGGCATGAGTCATCGCTGCTGACCACACCTTTCATCCACCTGAACTCTCTCTTCGGCGTTCGAAAGTCATCTGAATCAGATATCTTCTTTTCAATCAGTGCGTTCACTGATCGTCGGAAGCTTTAAAACCCAGAAACAAGGCGCCCAGTAATAATGATAAACACACAAATTCGTTTATGTAAAGAAATACTATAAAATTTGAAAAATATTTAATTTAGAATAATACAAAATATAAAACTTTTAGGTCTAATACAGATGTATACATTGAATTAATTAATTTTATACCATTCCAAATCGTCAGGTTTGTGGGAAGACGGCGGATTTACAATGGCCTGTGCGTCATTGAACAAGTTACTGCAAAGATTATCCTCAATCTGAAAGCGTAAAGTGGGCAAAGTGAGGTAGTGGCGTGGAACTCGGTTCGCCAACTCGGCGGTCGGCAACTGCGAATGCTTACCTGGAGGGAAGACACTAAGTTATCTGGGCAGTCGAGCACGCTAAGCCCAGATTCTGC AAAGGCGAGGCATGGAGCGATAAGGAGTGTGGAGTGTTCGGCCTCTATCTCAAGATCAGTACTATACTATATAGTGAAAGCAGAGATGCCATGGGAATTACGTGATCGGCCCCCCGCCCACTGCGCACTCAATGTTATCTAGCGATATCGCTACGATATCTGTGTGTCTCGTTGTCTTACGCTAGTCGGGGTGGTGGAACGAGACTTACGCATTCTGGGATCATTCCATGAAGTCGTTCGATCAATGTGATTTATAAAGTAAAGATCTCCGGACTCGGTAACTGCCTGCTCCCAACCATCCGGCAGTGGACCCAAATTGTTAGCAATGGTCGATGTGGTAGTTTGTTTTGTAGTTTGCAAAACATCTATCGAACAAAAACAATGAATTACAAACCAAAGTAAATAAAAACAAATTAAAATATGTCTTCAACGTAATGCTGCAGTGTGTAAGCGGATGAGAACGGAGGGGCACTGGCGCCCAGCATGCAGCACATATCAAAATCAATTGGAGTATGCTCAAAGCAAATCCAATCGAGCTCCCACTTCCGAATGCCAAAATGATCAGACTCCAACCCAATCCCGAA


Search Again