CR00808

CRIMIC CR00808

Gene CG9945

CG9945

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK79296

Images

Construct Sequences

sgRNA sequence
GGAAACACAGAAATGGCCTTTGG

Amplicon 5' Amplicon 3'
CATTTACGATGGCGCCAAGGGCACTTATCACCTGCTGAATCGCATCCGAGCCCGCGATGTTGAGTGGAGCATCATCGATGCGGATTTTAGTCCGAATGGCGAGCACTTCGCCTACAGCACCTGGTCCCGCTCATGTAGGTACTCCGCCCAATCTGTTTATCCACACTAAGTTGTTTTCCCCTTCAGTGTTCATCATGCCCGTGAATGGGGGGGAAGACGACTGCCAGTGGATCGATGTCAATGGACTGCCAAGCCATAGGTTGGCCATCTTCTCGCTGCGCTATTCGCCAACAGGCGACAAAATCATCGGGGGCAGCAACAATTCCACGGTCATCGTGACCGACATTCGCACAAGAAACACACAGATCCTGCGCACCCACCGCATGCCCGGCAAGGATGTTAACTCGGTGTGCTTCCTACACGATAAGGATCCAAATGTGATAATCGCCGGCTGTGACGACGGCCTGCTAAAGGTCTACGACCTGCGCACCACCTTCCGTTCACGGGACCTGTCCAAGTCTGTGGCATCCTTCATCGGCCACTACGATGGCATCACCTACATCGATTCGCGCAACGACGGCTACCACGTGCTGTCCAACTCCAAAGACCAAAGCATCAAAATCTGGGACATAAGGCAGCCGAGCAATATGCGTAATCGCAGTCGTTCTAGACAGCAAGTCGACCCCACCACATGGGACTACCGATGGAACCGCGTTCCGCGGGAATGTAAGCTCGTGCCCGTTTTATTCTTGGAAAATTTTTAACGCCCACCTATCTTGTCGGCAGTTTACAATCCGCATAAGCCACTGGAAGGAGACTCCAGCATAATGACCTACCGCGGTCACCGAGTTACCAAAACCCTGTTGCGGGCGAAGTTCTCACCCATGGAGCAGACAGGGCAACGCTACATTTACACAGGCTGTGCCACCGGACGTATTATAAGTGAGTTCACACCTTTATCTTGCAGTATTTCTCTGATTTTCTTTCACAAGGCTATCTAAAATACATTTTCTAGCCAGTAAGTTCGCCAAGTATTTTTAGAAATTCTCTATCCATCAAAAATTTGGTTGTGAAACCAAAGGCCATTTCT GCCATTTCTGTGTTTCCGTTGATAAACATATTATGTTTTCAAAATAATCCAATTTTCTTACAGTTTATGATGTACTTACTGGTAAGATTCAAGAGGCTATTGAAGGACATAGGACTGTGATAAGAGATCTGGACTGGCATCCGGATCGCTCAGAAATCGTGTCTGGCTCGGTAAGCATCGAAATATGAGTAATATTCCTCTGAATAATAATGCACACTCAACTGCCTACGCAGTGGGACACCCATGTTCACCTGAACAACTTCAGCCGCAGCAACGCCAATCGTCCGGTAAAGCGATCACATAGCTCGGATCATGACAAAAAGCCCCTGAGAAGATCACGACGTTTGGCGAATCGAAATGTTACACCGGACTAGTTGTAAGGTTTAGAGTATAAGCTAGTAAGGTCCCCTTTGATATTACATTTCGTTACATTCATTCATAGTGGCTTGCCTAAGCGACGCACGAGAATATTCACCACAGTCGGGCCGGCTGGGATAATTGGTTCTATTAAATAAGACTGAAGAATATGTCACTCACTTGAAATGTATAGTTCAGTTTAATTAGTTAGCGTGTTATACAAAACAGTACATTAAAATGTAAACCATGAAGCTTACCAACTACCTACTTAAGTTGTTTATGTACAAAAACAATCATAATAAGAATCACGTTGAAATATATTTCGTTTGCTCGATCTAAATTCCTTGAAAGGCGACTCTCTTCTTGACCGCTCGTATGCTAGTTCTTTGCACCCTTACCGGATACTTGCTATGCTGTTTGCTTTTAAAATGCTCAACGGCTTTGTTTTTCCAAAGGTTGCGAATGCGCGTTTCATCGTAAGGAC


Search Again