CR00806

CRIMIC CR00806

Gene levy

CG17280

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK79295

Images

Construct Sequences

sgRNA sequence
CACCAATCGATCTTGCCCAATGG

Amplicon 5' Amplicon 3'
CTTACCTTTGCAGGCCGAGATGAGAAAGTAGCCGGCGTCGCAGATGTCGCTGAAGTCCAGGTGGACCACGGGTCGCGTGTGGCCACTGCAGGTCAGCGGGATTTGTCGCAAGTTGTTGGCGGCCATGGCAGTGGGCTGCTAGTGGATTGGTGGACTGTGTGGTCCTTAATACTTGTGGTTTTCTCCGAGTGTAGCGACCGTTATGTCCGCTGGCGAACTGTGCACTTAGTGAATAACTGACGTTTTGTGGCTACTTTGTACTTGGATTGGTTGTTGCTCCTGGTTAACTGCGCTTCACTGCCCGTACGATAATGATTTTCCCGTTCGTTGCTTAGGTTCGAGATGCTGCGGTGGCTTTGCAGGGTGTGCAGTGTATTTACAATCTGATGCACTGAATTTTATAAACAAGAGGGGAAAATAATTACGCGACACGTTGTTGTTGTGGATGGACGATTGGTAGCCGACTCCAGCCTCGATAGTCCGCACACACAGTACCTACCTATCGTCAGCGGTGGGCGCGTGAGGCGATAACTTCTCGATTAGCTAGAGCTGTGTCACGGCAGCCAGGGGAGGATACAAAGGAAAAATGTCAAATTACTTATTTACAATTTGGCATAGAATTGTTTTATTTTGTTTTTTATTTATATTAAGCCAATTAACAGCTTTGTTGTACGTAATTTAGAAATCACGGCCAACCACTATCGATATAATTTAGCGAACGAGTCACGACATTATGGATGTAGCCCATCCCTATTTACTTGTCAAAACAGCAAATTTTCATTCGGGCCAAGAATCGACTGAAAATATGTCCGCTATTCTAAACCACGCAATTCGCCGCCAATTCGGCGCTTCTGCCGCCCGGAATATGTCCGGCACCGCCGCCGTGGCCGGCGAGCACTCTGGTAAGTGACCGTCCAGCGTCCCAATTGCCAAATTCATCCCCTTTTGTAAGGTTAAGGTTATGTAATTTACCATTGGGCAAGATCGATTGGTGGA TGGTGGAGAAGGATTCGCTCTTATAACACATCCTTTCATGCTCATCTCATCTCTCATCCTTCAGGTGGCTACAAGGTGTGGAAGCGCCTGTCCTTCTTCGTGGCCGTGCCCGCCGTGGGACTGTGCATGCTGAACGCCTACCTGAAGCACCAGGAGGAGCACGACAAGCCCCGCCAGGAGTTCGTCAAGTACGACTACCTGCGCCGCCGCGAGAAGCGCTTCCCCTGGGGTGAGGGCCAGAAGAGCCTGTTCCACAACCCCCACGTTAACGCCCTGCCCGACGGCTACGAGCACTAGGTGGCCACCGTCTCCGGTTCCCTCTGCGGGATGTATTCGTTGTTTGGTAGTGATAGACGTTAATGTAAACTGAACTTTACGCGGAAATACACAGAAAACACATATACCCAAACTCCAGTTGGCGCTTCAATAAAGATCAAATTAGAGCGAGGAGAGATCCCATAAAGACCATTTCAATGAGCGACAGCGGAATTCTGGTGAGGAGTTTATTTAAAAGGCCTTCGGTTAAAGGAAAAATTAAAAGTTACAATTAAATAGAATTTAAATTTAAGCATAAGCACGGATGCACTTTTCGCATGCAATATATTCAACTACTATCATTATTTTGCGGATCGGCGATTCTTAAGGTTGCGTTCCAGTTTGTGATGAGGCTTGCCTTCGTTCTTTCCTGTCTTCTGAGTGATTCTTTGAGCATCCCGACTGCGAGTTTGGCGCACGGATTGCTGGGCATCCTTGGGAGGATTGGTTTTACGCTGCTTTGGAGGCGGCGGCGTGAAGGATTCGTCGCTATCGTCTAGGTGG


Search Again