CR00805

CRIMIC CR00805

Gene RYBP

CG12190

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK80674

Images

Construct Sequences

sgRNA sequence
GCTTTCTTGATCATGTGTCATGG

Amplicon 5' Amplicon 3'
ATCAGCACCATACGCTAGCCAACACTGGCTGCGCGCTACTATCGAAATATCGATAGCCTGGCATTGAGCACTTCTACGATATGGCAATGTTGCCGCAGCCAAAAAGACAATTGCAGAAAGTTTTTTTCACAACAAAAAGCCACCGAAAACGCTCCAATTAAGCAACAAATGCGTGCCAAAAGCGCAGCGAATCTCCACTGAGGCCACCGTGTGTGCGTGAGCGTGGCAAAGGTGCGAGCAGAGCAACCAAACATCACAGGAACACGGCCAGCAGCAGCAGCGGATCAGCAGAGGGGCGGGCAGAGGCAGAGGCGGTGGCAGAGGGAAAAGTCGGGCATTTTCATTGGATTCGTTTTGGTCCGATTCGATTGGATTGCGGTTACTCCAGCGGCGCCCAGGCGTTCCTCCTCTCCTCCTGTATTATGGACAAGAAATCCTCGCCGGTGCGACGACAAAAGCGGCAGGCGAAGGTGATCGAGGAGAACTTCTGGGACTGCAGCGTCTGCACATATAGAAACTCGGCGGAGGCCTTCAAGTGTCGCATGTGCGACGTGCGGAAAGGTAAGTGACCCCGATTTTGCTTCGTTTTCGCTTCCGAGTTCCAAGATTGAGCAGATTGCCAGCCATGTTCCGATTTTCGC TCATGGATCGGTTTGTTTATCCTTCTACAAGGATACACACACATCGGTATTAACAATATTGGAATATATCTGGTTGAACTGTAGATAGTAATAGTCAAAAAAAGACTGTTGACTGTTGATTAGATGGCCAACGATGGTATCGATTTGCTTACGTAGAATAAATAAATTCACACTGCGCAGAAACCGGGAATACTTCTCGAAACGATAAACATGCTAATTGAAACAATTTTAAACTATTTATATACTATTTTTGGTGCGCTCAATAAGACTATACACCCTTGTTTTTTAGGAACCTCCACGCGAAAGCCACGCCTGAACTCAGCGCTAGTCGCCCAGCAGGCCGCCACTTTGCCAGGAGCCAGTGTCAACATGCCCAACGGGAAGTCCGCCTCCGGATCACGGCATGGCAGTGGGCACGACCGGCAGAGGCACAAGCGGTATCCGGCACGGTTGAAAAACGTGGACCGATCGACGGCACAGACGCGAGAGGTGACGGTCAACTCGGTGACCGTGTTCATCACAGAGTACAAGGCCAAGCCGGTGAGCAGCCGACGCGAATCCAGTGAGCAGAGCTTCAGCGAGAGCAACGACAGCCGGAGTTAGAGGAGGGATACAAGGCCTCCTCGCCCCCAGCTCCCCAATATTCTACGCCACGGTTCCCGCTCCCCTGTTACAAGTTGTAAATTCTAAGTGTTAGGCCCCTGGCGATAACAATTGTAAATCGAAATCCATTTAAGTTACCAAGTATTAGGCCACGTTTAAAGCCCCGAAAGCCAAGCCCCCACTAGTTCATGACTTCCAGCCCAGGCCAAGATGGCAAAGCAAAGCGAAGCGACGGCGAGTCGATTGCATTTACACGACGCTCTCCAAATCCCATTTTAAAATGCGCTAGACCCTGTAAATAGCGATGCATGAGTTCCCTGAATATCTCTGTCTCGTATCGTAATTTTAGTTGTAATTTAATTCTGCTACTCTAATTCCTAATTTATTGATGCAAAGGTAACTATGTATAACCGCCGTGTACATGTTCAACAAAGATATCATTTGTTTTGTAAGTGTCGAATTAAAATATGGTTTAACTAAGTGCAAGTTAATCTCAATGTTCCACTAGCAGCGC


Search Again