CR00803

CRIMIC CR00803

Gene CG8321

CG8321

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 no band OK80673

Images

Construct Sequences

sgRNA sequence
GTATATCCCCGGTGTGGCGGGGG

Amplicon 5' Amplicon 3'
TTCGGGGGTGTGACGTTTTTCTTGTTGTTTTTGTGCTATTGTGAAATAAACCAAACAATTGTCGAGTTAAATAGACACTGATTGTTGTTTTGCCGCGCAGTTCGAACAACGAAAACTAATTCCAAACAAAGCTTACGCCGGCAAAACCACGAAATGCAGGTGGAACCAGCCGAAGTCGGCTGTGACGTCACGCATCGCCAGCAGGAGAAAAACAAAACCAATGGGATTTTCTCAACGGCAGTCAGAAGTAAAAAAAACGGGCAACCGAACGGACGGATCTACACCTCCACGCCGAAGACCTCGCATCCGAAACTTGAGCACTACGTAGGTGTTGCTAAACCCTCGGAAAAGGGGCGAGTGGGAGTGGTGACCGCCCTCGATCCGCTGATCAAAAAGGTGGCCCTTCTCTTTGGGACTCTTATCATTGGCTACAAAAGCGTCATCTTAACGAGTAAGTGTGCCAAGCTGGGGGCTAAACGTAAATATATTGTGGGTTTATTGGATTTCCATTTGTTTATTTCTGTATATCCCCGGTGTGG GGGGGTGGGAATTCAAGGTTGCAATTGTCGGTTGCGTCGTCTTTACTCGCACTTTGTTTATATTCTCGCGTTTATAAATAGTTGAAGTTCGTGTGATCTCATAGCGGTGGTGTTTGTTCCCCCTGCATAAGCCGCCGAATAGCGAAAAAACGTCTATATAAGGAAGGCAAATTGTTTGATGCGCATTAGCCGTCTCATTTGCATACAAACGTACTGAAGACCTTAGAAAAATCGTCAAAGAGTGATTAGTTGCTTCATCTTTGAGGCAAAATGCCATTAGTTAGTTAATTGTTTGCCCAGCGGCTATTAGTTATTCATCTACGCTTAGCTTAACGGTATTTAGCACTGGGCTTTCGTCACGCGACACATACATGTATATTCTAATGTATGTAATATAAACATTAGAAGGTACCGCTAGAAGGCCCAGGAAAATAACGAATTTTACATTTCTGACGATATAGCAATCTTTATTTGCTGCAGGTTTTGCATTAGGGTGGCTCCAAAAAAAGTGCGACAAAAAATTTAATAAAGTTTAACAAAGCTCAAAGAAAAAACACATGTTTAATCAACTATTTGTTAAATAATTCAAACATATAAATTTGATATAAGCAGAAAACAAATTTTATACATTGTCGAGAAAAGAAATAATTAAACCAATACAAACGAATATTTATTTCCAATCTTTCCCATCGGTCCAAATCTATAAAAAGCGCAACCTTGCTATTTATGGTGTAACGAATGGGGTTTCTGTACATTTTTGCAAATTTCTTTGCCCACTAATTCTTTCCATTTAGCCAAATTGCTTTGATTCCCTCATAGCGTACATATCTGACTAATAAATTTGAACCACCCTAGTTATAAACCCAACATTTTGACGTGTTTATCACGCTAGGACTGATAACAGTGAAATCAATAGAACGACACTCAAAATGAGATACTAACGAGCTTTGGGCGTTCTCTTTGCAGTGCCATACATCACGGGCGATTCCATCCAGGTGCTGAGCCACCAGGTGCAGAGTAGGTG


Search Again