CR00800

CRIMIC CR00800

Gene CG17765

CG17765

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK80671

Images

Construct Sequences

sgRNA sequence
GTATGCCAAGAACCAATGAAGGG

Amplicon 5' Amplicon 3'
TATCGCTTGCCCAAACCAGTGTTGGTGAACGCCCTTCTTGTCATCTGTAGTTTCATTAAAATTGTTTTGTCCCTCAAGTTCCAATTAGAATCGAACTAGGCTCGTGACAAAATGTCTTATGTGAGTGTGTTTATGCTTAAGAAAGTGGATTAAATGTACTTACTACCGTTTATCCACAGGGACAAGGCTATAACCCGTATGCCCAGCCCGGTGGTGGCTATGCCCCGCCGCCAGGAGCATTTCCGCCGCAGAATGCCCAGGTGTCTCCGCAGGCACAGCAATGGTTCTCCATGGTGGACCGCGACCGATCTGGAAAGATAAACGCTTCCGAGTTGCAGGCGGCCCTGGTGAATGGGCGTGGCGATCACTTCTCGGATAATGCCTGCAAGCTGATGATAAGTAAGCTTAAGCCCTGCCCAAAAAAGATCCCAAAGTTTCCTCTACAGGAACTGTGACGTCAGTAGGTGAACACTAACAAACGTGTATACACTGTATACTATACAGTAGACCCTCTAAAAGACGATCATAAGCTAAACTAGTTTGGTAGGCAATATAGTAACACAAGAACACAAGAACAGGTTGTCGATTTGAATCTTCTATGCGTAGCCTAGCACACCCGCTGTATG AAGGGCACATGGGCACATATATTTAGATCATCCTGTGAGCTGATGATAGCTAAGTAAGCTTCAGTTATGAAATACTTTAAAATTCCTTCGATTCCCCTTCCGGAAACTGTGACGTCAGTACTCCCCTAACAGACAGTCAGTATCAATTTAGTTATACTTTCGGCTATAAATGTTTCACTGTATTTATTGCCCCAATTTAGGGTACATGCATATTTGTTTAGATCACCTGGAGCGCCAGACACTTTTCCGTTTGTTTACCCTGCGATTTATGTTGTATTTTTATCGCCTTTTTTAATTTACTCAACAGGCATGTTCGACAACGACGCCAGTGGTACCATCGATATCTATGAGTTCGAGAAGCTCTACAACTACATCAACCAATGGCTGGTAAGGTATTTCTTATATCGAAACTAAGTAGTCTGACTCATTGTATCACTGTTGCAGCAAGTCTTCAAGACCTACGATCAGGACTCCTCTGGACATATCGAGGAACAGGAGCTGACCCAAGGTAAGCTAACACAACAACTGAATCTCCAATTCCTTTATGGCCTTTTACACTAATTACCAAACTTGTTGGCAGCCTTCACCCAGATGGGCTTTCGATTCTCGCCCGAATTCATAAACTTCCTGGTGAAGAAGAGCGACCCCCAGGGCCACAAAGAGGTGTCCGTGGA


Search Again