CR00799

CRIMIC CR00799

Gene Epac

CG34392

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK80670

Images

Construct Sequences

sgRNA sequence
CCTGGGAGCTATTAATCCTGCGG

Amplicon 5' Amplicon 3'
TTCGTCCTGGTTAGCCACACATTCATATGGTGAAAACGCGTAAATAGCCATAAATGTGAGGCAGCCCTCGTGCACTTGATGGTTTGCCAACCCCCCGCAGAGTCGGAAATATTTTAAATTGGATTTCAGCGGCAGATGCACATGCAGTTGGCAAATAAACTCAATTGATATATGCAGAATTATTGCCGGTATGCTGATACGAGCGACGTGGATGGAAGCGCGATTTATTATATTTGTTGAAGGCAAACAAGCTCTTTGACTATTTTAATTAACACAAAAGCCGAGTGGGAGCTTAAACTAGTTATCCTTTCATTGGAGCATTAAAAACGGAAGTGCACGCATACGGACTAATAAGCCTGCAGACAAACGGATCCTGACAGTTGGATTTCCTCTGCTCAGCTGGGGAGCTCCCCACCCATGAACACAATGGAAACGAATTCCATTCTTTGGCAACTCTTTGATAGTTTCTGCCTTTGCCATCCGCTCAAGCGTCGGCTGGCGAAATGGCTTACAAATTGGACGGGGGCCTTGGCCGATACTTTGTTTCTATTTGAATTGTTTGCCTTAAAATCGCACACAATGCCGCTTGTTGTCTGTCGCTGTTGCGGAGGAGCTTGTGGCCAGTTATCTCGACCGTTGCACCAAGTGGGCTGTGGTATAACTTGTTTGGCCCATTGTGGCTATGCGGCCATTGTCCGTTGAGCTGTCAGCCAGGAGGAGGAGGTGGGAACCACAGAAGGGTTCAGCATGAAGGGTTTTGGTTTCTCACAACTTTTGGCCGGAGAGACGGACCAGCCAGTTAACAATTGCTCAATGGAATCGTCGCAATTGGTGCGCCATCACTCACCTGGGTGCGTCGTTTATCAAGGCCAGTTTCCCGAAATCATCCCCAGTCTTCAGAGTGGCAACAGTTCCCTTGCCGTGTATCACAACGTCTACCGATCCCTTGAGTAAGATGTACCAGGAGCGTCCTTCGTCGCCTTGATTGAATACTGTTAATGGGTTAAGAGTGTTAAGGGATAAGACTCGTTGTTAGTACTTATAGCTGCGTCGGTGTGGGTTGGCTGACCCATTATTGAGCCATAATTAGCCGGGGCTTAATTAAAAAGTTTTCCAACTTCTCCCTTCCCTCCCTTTTCCACCCTTTCTCCGCTTTGGAGAATCTCAACTGCGCCGCCTGGGAGCTATTAAT GCGGCCGGATACTCACATATTGTTCCCGCCTGGGCATGAGCCTCGAACACGAAAATCGACGACAGTTCCCGCTTTATGCTGGTCGACAAGTGGGAGAGTGCGGCAATGTGGACCAGTTCCTCGAAGACCAGCTCCAGCTCCTCCGATGTCCGTTCGTGAGAACTGCGAATTAAGGAATATAAGAAATGAAGGGATCTTAATCGAATTTACAGGTGAGAATTCATTATGCGGACGCAGTGCAATGTCCTTTTTATATATATTTATATTTGAGTATCGGACCCAACTAATGGCAGTAAAAGACTCATACCTATGCTAATATTAAAATATTTTAGATTTATTATCTAAAGTATCTATCTTTCATTACTCTGCCAATGCAATATCATTGAAGTATCTTTGTAGTAAGTTCAAAGAATTAAAATTGTAACAACTGTCTTGAATACGAGAATGTGTGAGTATGGGAATGTATCGTTGGTAAGGACTTAATTTGTGTTAATTGGTTCACCGCGTTGTTTCAATAGTTCTGACGTCTGTGTGCGGAAGTAATTATGCGTCACAAGTAAATTATCCATATTGCAAACGTCCGTGGGAAACGGACGTAAATTACTCATTGAATTATAGTATATTGCACGGTTTTTTATTACTTTTATAGGAATGTTAGTATATACATTAAATGCTTTATTTTTTAACCCTAAAACCTATTCCCATTAAAGCCGCCGTACTTACGGTTTGCGCAATATCATACGCAGTGTGGCGTCCGGTCCGCGCTGGAAGAGTGCGCTGAGCGCCTCGCGGATGTGCTCGTTGGCCGCTCCGAGGTCCTCCGCCTGGGGCACGCCCGCTGCCGCCGTGCCGCCCTCCTCGTCGATGCGAAAGCGGTAGAGGAAGCACTTGTCCTTGAAGGGCTGCTCTTTGTTGACTGCGGAACGGCACCGATTAGGGAATTGAGCGCGTGGAGTCTGATGGAACTTACCGTGTGCGAGTACTCCTTCCTCGAGGAGCGCTTGCCACATGCCAGCCGCCTGGGCTCGGGTGTGGACGATGGGCGAGAGGTTGACCAGCCAGTC


Search Again