CR00798

CRIMIC CR00798

Gene Magi

CG30388

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK80669

Images

Construct Sequences

sgRNA sequence
GGACTTTGACCGCAGTACTTCGG

Amplicon 5' Amplicon 3'
AGTCCGTGTGTCGTTGTTGATAATGATTGACATACGATTATTTGCCAAGATTGTGGCTAATTGCACACGCGGGTTTCGGAGAAACCGTTTAGCCCAGATCCTATCAAGACAGCTCAATCTGAACGCCAAACGGCGATGCATTAATGCTTCGGTAAATGTCTAAAAATAATTAAAACAAAACACAAAGCACGAGCCGCAGAGCATGGAACTCTTGGCCAACATGTGGTACAACAATTGTAGCAGACACAAATACAAAAATCACCGAGTTACGTGAAGTTGTACACAAAATATGCGCCGTCAGTTCATTGACTTTGACCCAAATGGAAAACAAAAGTCGAAACGGAAAGCTACGCACGCGTCTTCTGTGGGTCCACCAGGGTCACGGGGGGCGTGGCAGGTCACGGGTGGAGCCCTAGGGGGCGTGACGGCAAACGGCGCGAGCTGCCTAAGTACCACCAGTTATTATTTCGCCTGCCCAAAAAGCGTTTGTAGTTGCTGCTTCAACTAACATTACAATTAGCTAATTGCCGATTTTAGTCATAGTGATTTTAGCTAATTTAGCTAAATAGTAGTATGAATTATTAGCATTCACTTTTAACTACTTATTCCTAACTGTCCATCACTGATCTAATAAAAGTTAATTTATGTGCATTTGAAACTCAACTTTGTAAGTTGTCTTCTCAAATCGTGTCACTTGGCACGATTTTTTTCGACAAGTTGAGAATTCAAGGAAATCGTTTGCTTAACTGAAATAACAGAGAAAGTCGGGACCTTCTACTTTAGCTGTCTGTATTTTTTTTTACCAATTTCATTTAGCACTGAGTTATGTATAAATCTGTTTTAAGTGCTATATTTTCCCTGCACAGTTTATAACCGGAACTTTCTCGATTTCTTTGTAATATAAAGAAACTTTTAATTGGCAAGGTGAGTGCCTCATGTCGCTGCTAACTTTAATTTGTGTAATTCCGTCGTAACGTCAACATAAATTAGCCAGTAATGAGATGCTTGTTCCGCCGCTTTCTTGCCCGCTAGATTCATTCTGCTGTCCAGTGCAATTTCCCGAGTTACGCAATGAGCCAGCCATGGGATGCCCCTCAATTAGTTGTCCAACTGAATGCACGAAACCATGGCAATTACTTCGCCCGCATTGCAGGCATGCAGAATGACTCCTGGCC GTCAAAGTCCAGGCCACTCAATTGATGTCATCGAGTCTACGCGACCCACTTGGAATGGGGAAGTTAAGTCAACGTCTTTGTTCTGGCAGGGAATGATGGGTGTGCCCCCCTGTGTCAGCTGTGACGACTCCTTCACGAACTCCTTGCCTGCTCCGCCTGATGATAGCATCTAATTGGCATTGCTGCTTCGTTAACTTGGCTCACATGGCATGCCATAAACTAGAGTTACCCTTCCGCTGTCGCAATCAAGAAATTAATAATCGCAACACATGATGTGCAGGGGACAGTGGAACAGTGGAGCAACTCGAGGCTTCAATGCGACCGGAGTTGGTTCTCGCCACATCTGCTAATTGCCACTGACGTGAGGCGTGAATGATAAGCAAGATACAATGTGCGGCTGCTCCAGGTGGGTGAGTCTAAAGTCGACGACGAGTGCGAGTTCGTTGCCACCACTTGAGACTTGATTGAAACTCCTGGGATTCCGGGCTTCAAATAACAACCCTTTGGCATTCATCTAATAAAATCACACCTTTCCCACTAATTGAGTTGCTTAACGCAGACGGCCAACCCAAAATG


Search Again