CR00797

CRIMIC CR00797

Gene SCAR

CG4636

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK80668

Images

Construct Sequences

sgRNA sequence
TTTGGTTCGCACTGAATACTTGG

Amplicon 5' Amplicon 3'
TGCCCTTGACGGACATTACCCGAAAGAAGGCCTTCAAGTCGGCCAAGGTTTTTGATCAACAGATCTTCTCGCGCGCCACCATGCCGGCACCAATGATGGACACATATGCCCAGTGCGACAAACCGCCGCCCCTCGACAAGCTTAATGTCTATCGAGACGATGGCAAGGATGGTCTTAAGTTCTACACGGATCCGAACTACTTCTTTGAGTTGTGGCGACAGGAGATGCTGAAGGATACCGAACGTGTGATGCACGACAAGGGCAAGAAGCTGAACAGACCGCGGCAGGATGGCGGTGCCGGCGGAGCTGCTGGACGTGGCAATAAGAAACAGAAGACCAAAATAAGGGTGCCGCACAATACGCGCGAACAGCAGCGACAACGTGCACTGGTGCACGGCGAAACATTGATGCCCAACAACGTCATCTACCGCACACCGAATTCCATGGTCAACGAAGAAGCCGGATACGGAAGTAAGTACTTGGCGAAAGGGATTGGTCTC TGCGAACCAAATTCATAGGCTGTTATTGGTACGTTCGTTTCGCGCACTGACTATTTGCACTTGTCTTGCCTATTGAATGGTACATCTATTTTAATTATCAATTATGTCCTGTCTGCCCGTGTAGTTCAGCTAGTCAAAATACAGACTGTGGGCGAGGCTGACATCGATTTGCGGCATAGCACTCTCGATGCGCACCACCAAGTTGTCGGTAATATCCAAGACGTAGGTACGATGATGGGGCCACGTAGCTTTCATTTCCGCCCGGCAGACATCCCACGATACAGATGTACCCGCCATTCATTCACCTACTTCACTCAAAAGCTCGCTAGTTTTCGATGCGCCTCAAAACCCAGTTCGAAGATCACTAATTTGTATTATTTTGAAGTTGCTATTAATTGAAATTAACCCACACAATCATGACCCAGAGAAAGGTGACCGAAACAAAGTTTCCAGAGCTTAAAAAATAAATGAAATGGTACTTAACATAAATTCCATCTAAAGTTTGATTAAAATCTCAGATACAGGATATATTCGATCTAATTCATTATTATTACACCATTAGCAAAATGGTCTATGGCCAGTCTAGTTCATCCTCCTGTAAGTTAGCAAGACTTTCGAACTTGATTTGTCTCTAATTTGAATTCACTGACTTTGTTCCAATGAAGTTCGTCTTGTTGATGGTAAATACAATACGGTCAGAGAACCTTACAATTTCATTCTCCGAATGGTCGATTATTTTTCGCAGCTTTTATTTATTTGCATGTTGTTTTTATGAACTACTCTTTCGTTGTTTTCGGTTATGATATTAATGAACGTGAACATAAATATGCATTGCAATTACGAATGGATCAATCGCGCAT


Search Again