CR00796

CRIMIC CR00796

Gene CG8401

CG8401

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK80667

Images

Construct Sequences

sgRNA sequence
GTTCAGTGGGCCGGTGATGGTGG

Amplicon 5' Amplicon 3'
GGTGTCCAGGGGGAGAGTATGCTTGCTACAAAACTAACTACGTATTATTGTTTATGCTAATTTCTGGTTAGTTCTCAGCATTGCCTTTCAGGCGAATGTGTTGCTGCTGCCTCCCTCGCTGAAACTGGGCGAACTGAATGCCAATGGGGAGTACGAGCAGCTGGCCGAGGTCTACCCGAAAGTGGTCAACGAGGGCCAGCTGAACAGGACGCAGTCCGGTGAGTTTGAGTTCATATATTATATATAGCATATATATAATATATATCATAATAACAATACATTCATTGAACCTATCGTTTGATTTACCTTTGTGTGTAGACCTCTGCCTCCGGGACATTGTGGAACTGAAGCCACCCCACTGCAAGCTGCTCTCCGGCGAATGTTTGGAACTTTTGGCCAGTGATGCACCAGCCTACGGATACCAGAGAACCCATCAGTAAGCGTACATATACATATATCCACCGCTTAAGACATCTAAAGCTAGACGATATTTCCATCTAGGGTCCTGCTGCTCTACGTGCTGGAGCATCAGGCATGTGCCCCCCACCTCAGCCCACCTCAGGTTTACGAACTGCTGGCCAAGAGTCAGTGCGATGAGGTGGAACGCGAGCAGAACGCCATCCGGAGCCTGGGGCTGCCAGTCGTGTATCGCGATCTGTATCTGGAGCAAGGTGAGCAGGGTTC GGTGGTGGTGATGCTGCTATCGCTGTTGCAGCTACTGCTGTTCTATGGGCTATCCTTGTTGGGCTATCGCTGACATATATCTTTGCCTTGCCACATATCTCTGACATCGCAGCCACCATCTGCGGCCTGTTTGGCTACAATGAGTTTGTCAACTGGCGCAACGTAATGGAAATTGGCAGCTGGCTGGAGGGGGACTCGCCGAAGGATATGGATGTATTGGCTGACGACGGCGATAGCCAGCACATAAGCGATTTGGCCTTGGTCTTCTACACAAATGCACTGCTGCTGCTGCACTAATCCATCGAACATTCCCCCAATACCAAGCCCATCCATAATTTCTGCTTCTGCTTGATAAGTTAATAAAGTGGCGCTTATTGCTTTATGGTTGTGTCGATTTCAGCAAGTGTCGTGGTTAATACTTTTGTTATTGAACTGCATCGTGGTGCAGTGATGCGGGAGGGGTGGTGGTGGTGTACTTCGCTGGGAACGGAAACAACATTTGTAATGTGACACATTACTTGCGCTTGGTTGCTCGCCTGATGGATATGCAGCAGGACGAGAGC


Search Again