CR00794

CRIMIC CR00794

Gene CG8858

CG8858

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK80665

Images

Construct Sequences

sgRNA sequence
CTGAAATCGAAGGATTGGGTGGG

Amplicon 5' Amplicon 3'
CTGGAGTGGCTACGCTGAAACGTGTGTCCGCGGAAGCCACCACCAGTGGCACGAATATCTGCAAATCACTAAACACACTGGCGCACAGGAAACGAACTATTCCCTTCTTGACCTTTTCCAGTTCTTCGGCCCGCCAATTGTAGGCGATGATGCGTGTAAAACTGTACGGGCTCAGACCCGGAGGCACATCCTGTTCCTGGGTGATGCCATAGGGCAGGAGGAGCACATCCTGGAGCAGTGCCAAAAAGTTTGCACAGATGGCTGGCTTGTCCTGCAGATCAAGTAGCTTTGAGCGCTGCGTCGGGTCGTCGGGAATCTTCATGTCCGACAGTACGGGCAGCAGCAGGGCGAACAGCTTGTCCTGGTAGCTCTCCAGCTTGTCCTCGCAGCCCACCACTTTGCTGGCCAGCGCAGTCTGTTGTTCCAACGCCAGGCGCGGAAAGCCCATGGTAATGAATATGATGGCGAAGTTCTTGAGGAAGGTGCTGCTATCCTGGGCGGCATACTGATCCAGCAGTGCCTCTACGGGTATTTGCACATGTCCGCGCGACGACAGGCGCCTCTTGATATGGGTGAGCACTTCTACGACCTAAACAAAATTTAGTGCATTAGTCAACCGGTCAATTTTGCAATGTCACGATGCGAGAAGGGTGTACAAAACCACCCAGCCAATCGTTGTTTGACCATCCACTTGCCTTTGTGCGCACCACATTGTGGGGCGAGTTCATTTTGAGGATCACCGGGGTCAGGAACTTGCCCACAGCGGCTTCCAGCTTCTCATCCGAGTCCGCATTTCCCAGACGCAACAGGACGCGCTCCAGAAGCTCTGAAATCGAAGG TGGCACAGCTTTGGTGTATTATCAGCCCATCTCTTCTATTCGCTGATGAAACATAAAGTTTGATGCACACAATGCTAATTATAATTTTTACCAATTTCTGCATTCGGTCCAGTTTCCATTTTTTTTGCTTTATTTTTGTTTCCCTCTTTCAGTGTTACCAGCTGTTGTGCTGAACATTTCACAGATGCCAATTTTTGGCTACATTCGAAAGCTTTGCAACACTCGAACTTTTCGAAATGAAACCGCCGCCAAATTCAAAATGTAAAGCGAAAATCTTTGCCATTGAAATCATTCAATAAAAACATAATTTGTAATCAATCAACTTTTATTTAAGAAAATCATATTAATAATGTACATTCAATGCAATTCGTGTCCATATTCTTGCGGTCATCTTTAGTTTCTGTAAAAAATAAGAAATCGTGTCATTAGTATGGAGTATTTGCATTTATTTCAATATGCTTTTCTTTGATAAATATCAGTATTCTCATTTTTATTGAGAAGAGTCAAGGTTCTTCAGCAATTTGTTTTATGAAGACCGTCATGATTTTATCATCAGAATGCCAGTTAATAGCTGCCTTACAAAATAATATATTTTACACACCTTTTAATGGAATAGCTGGCTGCACGACTGCTGAAATGCTGTGGAAACTGAGAGAAGAACTGGAGAAAACCCATGGTTAAAGTTACTTTTTTTTGTTTTATTCAAAAAGAATAATTGCTACAAATATTATCGCCCGAATGGTAGTTGTCCGCTCTAGTACTTCTTGAAGCTCTTCTTGGCTCCCTGACCCTTGCTGACTTTCAGGACGTTGAAGCGCACAGTCTTGGACAGAGGACGGCACTCACCAATGGTGACAATATCGCCATGCTCAACATCTCTGCAAATTAAGAAATAGCACGGATTAGTAGGAGGCC


Search Again