CR00793

CRIMIC CR00793

Gene Nup54

CG8831

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK short band80664

Images

Construct Sequences

sgRNA sequence
TGTGGGATACGTCGCCTATGTGG

Amplicon 5' Amplicon 3'
GCCGAATCCGCTAAAAGCTGGTGGTGCTGCACTAGTCGCTGGAGCGCCGAACAGACCGGCCTGACTTGTTGCCGGAGCTGCTCCAAATCCGCCGAAACCGCCTCCTCCCAAACCCGTGCCCGCAGTTGTGGTTGTCGCCGCACCAAATGCCGGAGTACTGCCAAAGGCGGAGCCGCCAAAGGCAGAAGTTCCTGTGGCGGCTCCAAAAGCCGGGGCTGCAGCGGTTGCTCCAAAGGCGGAACCTGCTCCGAAGGCAGAAGTCGCCGGTTGGGCGCCAAAAGCCGGAGTCGATGTGGCCTGTGCTCCGAAAGCGGGTGCTGGCTGGCTGGTTGCAGCTGTGCCTCCAAACGGCGATCCGAAGAGGCCACCGGTTGCTGAACAAAAGAGATAAGAAGACCAGAAATGGGTCAGTGTTTTGAAAACTATGCTTCTGCCTTGGATTCTTATCTGAGATTTCGGGTTCCAAAATACTACAGAAGCTGCCCTTAGTTTGCTTCAAGCTCTGGTCGCCTGCTGGTCGTGGAAAATGGCTCTGGTTTTTATATTGCTGATCCTCCTGCTAGGT GGTCCACAAGAAGGGGTGAGCATCTTTGTCTGGCCACATAAGAACACTGACACCATGTAGCCCGTCCCACATCCAGCATAGATCCCAAAGACATCCGCATCCACAGCCTGCAGGACGCCAAGAAGCTGCTGAAGCCTCCACCAAGTGGAAATGGACCCCACAAATATTTGGAGAAAAGGGCATGAGGTCTTGTTTACGGAAACTCACTTTTGGCCGGCGTGCTTGTTGCTCCCAGCGACGTGTTGGATCCGAAGAACGACATGATGCGGTATTCTCAAGGACGTTACTTTGCCGCACAGTTTGGGTTGCCTTTCCTAGGGGCCGGAATTTGTACAATTCTATTTTATTGTAATAAAATTAGTCTTAATCCTAATAAACGTAAAATTTTGGCGCTTTCTAGCAGTGTTACCAGATTGTAAATGGGCTCTCACCCTTGCTGACAACAACACTTGAATTTCCCTTATTAATTTGGTAACACTGCCGCGCGGTCTAAATTATCGATAGTCTTAGGCCCGACTTTTGATTATTAGTACGCTATAATTTGAAATTTGGCGGCAAGAAAATCAATTCGCCACTTCAATAATCCTGTCAAGTTTTTAATTCTAGTTTACGCCTCCTCTCTAATGTTTGAACTGAATATAATATCCTCCTTTCTGATCATTGCTTTTCTTTTTGATATAGTAACTTCCATGAATGGATACTATTTTTGTTGTTTTCACATTAAACTCTTTCGTGACTCTAATAATTAAACACTCTTTGGGCTTGTTCTTTTCTTTATTGATACACTTATAGCATAGCATAGTATAGATTTTGGTTATCAATAGACATACACCATATACAAATTTCCTTGAAATTATTCCAATTTAATTGCAATAACGTTCAAAATTCATCGCAACCTCTGCTCACCAGATCCAA


Search Again