CR00792

CRIMIC CR00792

Gene CG31635

CG31635

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK80663

Images

Construct Sequences

sgRNA sequence
TTTCGGAGCCTGTTGAATTCGGG

Amplicon 5' Amplicon 3'
GGGGAAATGGGGTTGGACATATGCGAATACCTAGGATTAGAGAATGTTTGTTTGTTGATTCGTGCGCTATCGATCGCATTGATAAATGAGTAAGCAACACAAACATTGTATTGTAGAATCGCGTGCCGCCGTCTGACTGCGTTTATTTCAATATTTTATTATTCCATCGATTTTTGTGCCTTGTGCGCCGCCTGCTGCTGCTGCTGACGTTGGCGATTCTCACTAAATTCACATCAGAAGTGGAAAAGTGTACGAATGTACGAATAGAGAAAAGCTATAGTAAGTAAGCGAGTAGCTCTGGCAAGAGAACCGGAAAAATTGTCCAATTAAATTGCTGTTAATTTAGTGCTAAACATTTACAATGTCGGAATCTTGTTCTCGCCGCTCTGTCATTAAATTTATGACTGCATTTTGGTTTACTGCAAGTTGGTCACAAATAATAGAAAAATACATAAATAGAAGACGGCAAGTTACGAAATTTGGAAAAAACCAATTTAGATTGAGAAAACTTGCGAAACAAACTGGTTTTAATATCATGTCTTATACTTTATTTAGCATTATATTTTATTAATTTAAGGCACGAAAGGCAAACACATGACCTTAATTAGTGGATTATAAAATATATATTGAAGTTTCGGAGCCTGTTG GGGAACCGAGTTGGCTTGTAATTCCAGTCAACCTGTTTTTTTTTTTTTTTTGACAATGCCTCTCATTCTTATCTGATTATTGATATCAAGCGCTGCCGTTGACTTGAATTGACAAATTGAATGCCATGACCGACGCTCGTTTGTCATTATCGGCCAGAAATTCTAAGGGAAAAGCAGACGAAGGTGTTTTTTTCTTGTTTCTTAAGAAGATAAGCGTCTCAATAGCTCTGGGCAGAAAAGTAAATTAAATAAATAAACCGCCCAAAATCAGCCATAAACACGCACCGAAATTGTAAACAAGCGTGCGAGTGGCGAAGGCAAGTTTCGTTTTTGGCTAAATGCAAACATTTGCGTTATTTGCGAAAAAGCTTACTCATATCTACTTGTTCTTAATTTTCTTTGTACCCTTTTGCTTTCGATTCGCATAAATTAATTACATCGCCAATGTGCACTAATCGAGCTCGTGACATTTTGCACAGCAATTGATATTCTAGTTATTATCTTTCGTGCCATTTCATTGACCGCTTGCATGTGAGCGTGAGTTTTGGCTCAAATGAAAATTCGAAACCGAATACAACGAAGTCCGTGCTCACGGATTTTCTACTTTTTCTATTTGTGTTGGCTGTGTGTTGAATGTATTTAAGAAATAAACCAAGTACTTCGCCAAATAATTAGCATACATTTTAGTTTTAAGGAACTTGAAAAAACAAGATAGATAGGTTTAACATTAAAACATCTTAAGAAAACAGAAAAAATGTACAACAATTGAAATTTTAATTCATTTTAATGAGAATTTTTGATTTGAAGATTTGTATGTTTAAGTAACTGAATGGATCACATACATGTGTATGTATTAATGTGCGTTCTTCACACGATTCTTATCTCGTAAGCCCGGAAAGTGATTTTGCTTTACTTAACAATAAGTAAATATCTAATAAAATGTGCATATCATATGAATAAAATCGCCGCTTTAATAAGTATCCTATTCGCGACCAAGTCATGTTTGTGTGGCCTAGTTTGCGCCTCGAATCGAGGTTATTTACTGGGAACGGACCTTTCTGTGATAAACGAACCCGGAAAGTGGATGGAATTTCTATTTACACAATTGTACTCTCTGTGGCGGC


Search Again