CR00791

CRIMIC CR00791

Gene Rcd1

CG8233

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK80662

Images

Construct Sequences

sgRNA sequence
AAACATGCGGGATGGATGGTAGG

Amplicon 5' Amplicon 3'
CGGATGAGCATGGTAGGGTCTTCACCACGCTGCCAATGTTGGCGGTGCTGCTTGTCCCGACACTCGGTTTGTTTAGCGTGTAGTTAATGAGTTTGCTCTGTGACGGTAGCGATTTGATTTGAACGAACTGGCTGGATGGGATCATCTTAATCTTGGTGCCAGCTGCGAGATTGACGGGCGGCAGTTGTTTTCCCAAAACACCGGGAGTTATCACCTTTGGCAGGCTCGCTGAACCACCTGCAGTGGTTTGGGCATCTCCATAGTCCTGGGCATCATCTAGTATGAATTCAATGGATTGGTTAGGTTCTTCGCCGCTCAGTTTTGGTTGGTCGGGATGAGGTGCACCTTTTTGGCTAACAGAGCGTGCCGAGCCACCGACATTGGGAAGGGGGCGTGTTCGGGGTCTTCCAACTGAGGGGGTAAGAATGTTAGTTTATGAATCGGGCGAGCCAAACAACAAGTGGCAGTAGAGGAAGACCCGAGATGAATTTACCCTTTCGCTTCACAGCAAACGGATCAATGAGGCGCGGTGGCTTCGGCTTGTGGACGCGATCTTCGTCGAAGGAACAATTTTGATTGGGAACGTTATGGTTAAGTGGTTAGTGATTAAACATGCGGGATGGA GTAGGATGATAAGGTTATGGCGATTTAATGGTCTAATTTTGGAAAACTGATACTTACTGTGAGGAACAAACTTTGTTTTGGAAGGCTGACCCATTGAGTCGTCTAAACCACCGTCCATCTTTCGCTTACGCATCTGCTGAACAGCCTTGTTTGCGTTTCCATCGGCCAGGATGTGAGGTGACTGCTTTGGCAGTCGCTGGTAGCCCTGCTGATGCATTAAACATGTGGGCATACGCGGTCCAGGTGGATTGCTTAGCGTTCTGTTCACAAACTCAAAGATTTCCTCCTGCAATTTATATCATAAGTAAATACAGTATTTTCATTACAAATATTCTATTTTGAACTTACGACAACCATGTAATCAACCATCGACTGTGTAACGCCTTCTATTCGCCGCTTGCTCTTAGGCACACGCAGTGCATCATCTGCACTACCCACTACGACCAACGAAGATTCGGACTGCATTCGTTCGCGTAACCCTTCCATTTCCTCCTGACTTGTGCGTGCGGAATTTTGTCCGATGACAAAGAGTATCGGCGCTTTTATGTCCAACATGCGGTCATCGGGGGTTCCGCGTGGCCCACGTATTGTGTTGTAAGCAAATCCCATGCAAACCACACAGGCAACGCTCTCCGATAGAGCAACCTGTAGAGCCAAGGCAGCTCCAGCATTAAATCCAACGAGTATGATGCCACGACTGGGGTTTTCTGTGCGCAATT


Search Again