CR00790

CRIMIC CR00790

Gene stmA

CG8739

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK80661

Images

Construct Sequences

sgRNA sequence
GGGGCAGCGCGGAAGTCGGGCGG

Amplicon 5' Amplicon 3'
TCCTCGTTGATGTTGGCGAACTTCACAAACTGCAAGGGCAGAGGAGTGAGTAGAGTAAAGTGAAGTGTTCCACTAAGTGAAGACTTACCGAATTGGTGGCCATTATCTTAAGGTTGGGGTTCGAGTCCTCCAGAAGCTTTTGCACCATCCGCAGGAAGGACTCAACAAACAAGTTGAGTGTGGTCTGGGCATGACAAGCCTGCAGAAGCAGGTCCATGGCCTCCATGGCAATTTCGGCTAGTCTAAACAAGAGTAAAGATTAACAAGCTGATTACGTAGCAAGTTCTTGACCCACTTACTTATAGCGCTTTCGGTTAATATCCTTGGTGGCCTTTTGGTACAGGTACTCCCCAATCCGGTCCAGCTTGTCCGGCGAGCTCAGCGAGTAGAAGGTCAGCTTCTCCATGTTCGACTTGACCAGCCCGTCCTCAGGGTTAACCGGGAAGATGTTATCGACCAAGCGCTTGTAGCGCGGCCTGAGCGCTGAGCAGCATCCACAGCAGCCTAGAAGAGCGCGGGGAAATGCACAGCGGTTAGAGGGATTAGGCAGACAAACGTGGATGCAGCGGTAGGTGAACATGGCGCCACCGCTCCGCTGGAGAGAGTGATGGTGGTGGAGGCGAAAGTGGTGGTGTGAAAACCGACTCGGGTCGACTGGGTGCGACCACCATTTTCCGCTTAATCTTATCGCGATAATTGCCCCAGTGGACTATAGTTTTGCTGTTTGAATGATTGGACGGCTCATCGCTCGTAGGTTGATGGCTTCCG GAGCACCACCCAACTCCATCGATTTGTCGGTGTCGTCATTCCTCCTGGCCAATTGACTGGTGGCGAGGTCATCTGGCTCAATGGCCCGTGGCACGCCAAGCTGATGACACCTGAGCGCGCCGACAGCTTACCAGGCATTTTGGCGTCGCGATTCGCTTCTCTGGGTGTTTATCGCGGCATTAGATAATAAAACGCAGCGATAAAAGAGCGCAGCGCGACTTTTCTTTTGTTTTCCTTTCGTGGATGAGACACTCTCGGCCGACTTATCGATAGGCAAGAGGTGTGACCGTGCGATTAGTGCAGGCAAATACAGTGTAGAGTGCGGTGTAAGAACACTGCCATACTGTAAAATAATAATTGTATCTGCTAACTTGCAAATGATGCCCACTGTGCGGGGCTACAATGTGCTTTTTGAATTTCACTTCAAATCAACAAAAACTGGAGCTATTTTATTTTTATTTAATAGTTAAGAAGTAACAAATTAACTATAAACCGTAGTCAACCTTTAAACTATTTTAACATTTAATATTTCGTACATGTTTGCCTTCAATATTCTTATTTTATTAATTTATATAAATATTTTTACTTTTAGAGAAAATCTCCTTCATTATATGTACTTACAACTGGGATCCGTGCACTTTTGCACGAAGCTGTCGAAGAACTCAGGCAGTTCCGGTGGCTCGAAGCAGCAGCGAATCAAGGCCATTTCGGGATGCCAATATCAGGGATTCAATCAGCCCGCTCCGCCCAGGACGTTGACCATGAACTTTGGGTATTTTTAGCGCGAAACTTTGTGCCTCCGCACAGGTTGTTGTTG


Search Again