CR00788

CRIMIC CR00788

Gene CG6495

CG6495

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK80660

Images

Construct Sequences

sgRNA sequence
CACTGGAGCGCCGTAGCCTCCGG

Amplicon 5' Amplicon 3'
CAATCGTGAAGATGCCGCTGCCTGGGCCAACCGCAAGATGATTGCCGAAGGGCAGCAGCAGCTGCCGCAGCAGCAACTGCAACAGCAACAGCAGCAACAATCATCGCAGCCAAAGACGGAGATCATCAACACGGGTTAGTATAGATAAGGGGTCTAGGAAAATATAGTTAAGATTAGAAGTTAGTTGATAGGATGTATTAAAAGCATATGATGTGTCAAAGATTAGATTTAATGATTATTAACACAACAAAGTTTAGGAAATGAAACTTTTGCAGCTGTAGTATACGATGTAGTTCCCAATTGATGATATCTGTCTTATCTATAGAATCTTCAACGCTAACAAACTTATGATTGGCAATCATACAGGGCTTTTCTTCATTTTTTTTATATAATTTATTTTATTTTATGCCTCACAACCCAGTAAAGCTGCTGCAGCACTGCACTAAGTTGCATTAAGTTGTTAATTAAACTCGATTGAGTGTCCAGGAGCAATTAGTTCTAGCCAGGCACTCCAGCCCAACAAAAACTAAAAGCTGAGTAAATATTTATGAGGACAGGGAATGGGGAGTGATACCCGGA ACATTAGCACACAAATGGCCGGCACAGTGCACGCAATGATCCCACTGCCATGGCCACTTGGCCACGACACACTCGCTCCCTTGTTCCGGAGGGCTTTTCTGCTGGGAAAATCGCAAATAGCCCATCAGTTTTCATTGTGTGAAATGGGAGCTGCCGTCGCTCGAAATTGATTTACGAATGCTTGTGCCCTATGCGTGCAGTGCCTCTGTCTGCGCGTAATTAATTCAATTAGCTGTGCGTTAACCGGGATACACACACTTCATGCTTCCTAGTGACGCCTTCGCCTCCGCTTTCTTACAGACGCACAGAGCCACATATTTAGCCATAAAGGCGGCCTCCAGCTGCAGCAGCCCGCAAACGGACAGGGTCCACCGCCGTCGCCACTCCAGGTTCCGGGTCAGATGGCGGGAGCAGGTCAGGTTCAGGTTCAGGGGCAATCCCCAACGCTGCAACTGCCCGGCTACGAGGCCAACCAGGCTGTATACGGGATGTCACGCACAGGAATCTACATGCCACAGCAGCCGGCGCAACTCCAGGCTCCAGCTGGCCAACAGCAGCAGCAGGTGCAAGCGAGTGTGGTGTGGCCACAGCAGGCTCCATTAATTCCGCAGCAACAGTCGCCCGTGCAGCAGTCGCAGTCCCTGATGCCCCAGCAATCTGGTCATGTCTATGCCGCCGCTGCTCCGGCCATCCAATCTCCGCCAGCTGCGCAGCAAGCCATGTTGCCAGTCCTAAATGCAGCACCCGTAGCTGGGAAAAATCAGGGTCCAGCGGCAGATGGGGACTACGATGATTACGATGAGGAAACGTACACGGAGGCACCAAAAAAGGTAAGATCTGATGAATGAATATAGATTAAGATTAACCATTCATTTTAAAACCACAGAAGCAGCACAAACACAAGAAGGTCAAGACGAAGACGGCCAAGGATCCCATTGAACTTGCCCTGGAGCA


Search Again