CR00787

CRIMIC CR00787

Gene unpg

CG1650

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK no bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
ACCAGAAGTCCGAACTCGTTAGG

Amplicon 5' Amplicon 3'
CGGAGTGACTGGAAACGGAATGCTGACGTTTTGACAATCGTAGCGATTTGGCGATTTGGACACTCGAATGGAATGGCACTGCGTTCTCCCATCAACGTAATCATCCGGATCCCCCGCTGCCTGTCTGGAAACTGGAAACTGAGCCATCCGTGCCGCAATCAATTTGCCAGCGAAGCAGCAAAGAGCGCAACAAATTTGCGACTAATATATTCATAACTGAGCGCAAGTGGGCGCAAATGGTGTGCTTTGTGGGTGGGGGTGGCTGACATGGGGGTGGCTATGTGGGTGACTGGCGACAGGGTGGCAGGCGTCCAAATGGGCAGATAAATCAGTGACAGCGGGCACTTTTGAAGCGTGTAAGTGTTAAAAACCGCTTAACCATGTACTCAAAATTAAGAGAAGTGGAAGCTGGAGTGGGAGCTGTAGCGGAATTGGGAGGACTCATCGGGCACTTGGCACTTGACACTTGGCTGGCACGCTCAACTTGAGTCCACCCAAAACAAGCAGATTATGTTTCGAGCATTCCATGCCTTCTGCATGAAGGGCAGCCTTCAGACACATGTATCCAGTTATAAATAAATATGTTTGCCACAATTTGTGGCACGGGCCATTTGCACCAGAAGTCCGAACTC CCATTAATGGGGCTGCTCCAAGCGACTTGTCTTGAGTCCGGACAGAATCAGCCAGGATGTGGGCTGGACCGAGGCGGCATTGCTCGGCACAATGTGTTAGAGTGACTCTGAACGATGGGATTGCACTCAACCGAAGATGTATCTCAGTATCTCAGGAAAGATACAATACAAAAGGGAATGGAATTTGGAAAAATAACAATATAATCCAAAGAAAAAGTGAAGTCAGTGTTTGGTCTTAACTTAAACTCTTGATACACTTTAAGTTTAGTTAAGTCCATTTCAAAGTTCGATTTTCTTAAATGGATCCGTTCAAAATGTAGTTAAATGTATATCTCTTGTTATTTATTCGGAATAAAATTCATATTTTAATGGCTTGCACATTGAGGAATGTGAACCGCTTTTGGGATAAATTTCAAGGCCAAAACCCATCAAATTTGAAATGAATAGCCATTTTTCAGGTGTCTACTATGTACTATACATACTACTATACATATTACTAATATGTTGTTCAATTTGTGCGTATAAACCTAACAATTTGCGTTTTTACAAAGTTATGTCCTCTTTGAACTTTCAAAACGAAATTTCAACTTTAAATAGAGTTTAAACAAATTGTTGAAATTTGTTAAGTAATTGTGTGAGTCTATGTTGTAAAGTGATTAATTCCCTATTTGGAGCATATAGGGTTAATTTGCGACTTTTCGCGAAAATTAAATTTTTAGCGCGCAATTCGTTGTTTG


Search Again