CR00784

CRIMIC CR00784

Gene Sin3A

CG8815

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK80659

Images

Construct Sequences

sgRNA sequence
AATTGACAGTGAACTGATGATGG

Amplicon 5' Amplicon 3'
CTTTGGCTTGCCTTCGGTTCCTGAAACAGTTGATGACGATGCCGCTGATGCTGCCGCCGCTGCTGAGGATGTTGATGGCGTAGCATCGTCCACAGGCGTCGCTGAAGATGCCGTTGCCGAGGACGCTGGTGCAAAAGATCCTGTCGTCGCTTTCGAGTCATCAGTCTCTTTCTTAATTCCCGCTGGTGTTACGCTGCTAGTGCTTGCATTGCTACGCGCCGGAGAGGCACTTTCACTGGGCGTACTCTTGGCATTTCGAGTCGAAGACTCCGTGCGACCCAGTGGCGAGTCCACGTCCATTTTCGTATTGTCATCTACCAAAAATGGAAAGGCTATATAGAGAAACGGTGTGCACAACACATATGTTCGGATATTCGATGCAGTTCAGGGGTCAGTGTGTGGGTGTTGGTGCATTGCAGTCCAGTTTTGGTTTTATTTTATTTAATAGCATTTTGATTACGTTACAAAATTTTGTTTTTATTTGTTTATGTTGTTTTTGTTATTAATTGCAAAAAAAAAATGGAGAAAAAGAAACAAAAAACATACACTATGTTAAAAAATACAATCGGGCAAAAGTTATTAGGGAGAAACTTTATGTATTGAAAGAAAAATAGTCATGCAAATTTCTATCGAGAAGTAAATTTTTTTACATGACTAGTTAACGTTTCAAAATCACAAAGCACTACTCCTTAATAAAAAAAAATGAATATAAATATTGTTAGTATGAGTACTGATGATGATGAGTTTTAAGTCAACTCTTAAAGAGATCTTGAAAATATTAGTTAGTTTTAGAAGCTACTAAATTAAAGAATAGTGTTAGCGCAACCGAAAAATTAAATATGTTGGAGGTTAATTGACAGTG TGACCACGAGAACTTACCGTCATCGCGTTCGTCATCGCTTAGTGGCTGTCGCGGCGCGAAGAAAAGGTCAGGCACAAATTGTCGGATGATCTGCTTAATCTTTTGCTTCTCCTGCTTCTGGATGCCAGTCTGACGCTTCACATGATGAATCAGCAGGTTGGCGGCATCGTCCAGAATGGTTTTATCCTTGTACGGCAGCACCAGATGCGGCCCAAACGGTTCCATGGCGTCGTCCTCTTGGTCGTGCCGCTCATCGTACAGCGTCTCGATTTCGTTAAACAGACTCTTTGAGCGCAGGGCTTTCATGTCGTTGGGCTTAAAGTTGATGGCCTGGTGATCGAGAGACTTGAGGTAGTACTTCTCGTTCTGTTCCCGCCATTGCTTATTGAAGGTCTGAAAAAAGAAGGGTTCATTTAATTTACATAAATGTAAAGCAATGAGAGAGTTCACTTACCTTTTGCGCTTCTCGCCACTCCTCCTCCTTGACTTTCAGTCGCTTCAGTACAATAGGCACCGCCACAAACGGATTTTTCTTCATTCCCGTGATTATCTCTCCCGACTTGTCGCCGTAGATGCGATGAATGGCCCGCTGGTGTATCGTTTGAGATGTGCCGCCCAGATGATCGTCCAGATGGAATTTGCTCAATTCCTCGGTGGACATTCGTGACA


Search Again