CR00782

CRIMIC CR00782

Gene Flo1

CG8200

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK80658

Images

Construct Sequences

sgRNA sequence
AATGTTGTTGTTGGGATAACAGG

Amplicon 5' Amplicon 3'
CCTCATCGCGCAAATCCTTGATGGTGTAGGAAACCACGGTTATTCCCATGTTGGCCAAATCGCTGGAGGCCACCTCAAACACCTGCTTGCTGAACTTCTTGCGGTCCTTGTAGATCTCCTCCACGGTCATCGAACCCATGATGGCACGCTGATGCCCCTCCAGGGTGACCAAGGCGATGTGGTTGATCTCTGCCTCTGATTTGCCCAAGAACTGCTCACAGGCGGTCAGCAGCATGTCCTCGTTCTGACCCTGGACCTTCACCTGTGCAATGCCTGTCACCGAGATGGGCACTCCTTGGCTGGTGTACACGCAAGGACTCTCTACCTGGAGGGTCATCGTGTTCAACGAAATTCTGGGGAAGATTGGCGGACATTTAACATCTGAGGGCTTGTTATCTTAAGACTAGGGACTCAGATACGAAGCCAGAAATATTAACTAAATATTATCTGATAAAATAAGATTATTTTATTATAATTTAATATATTTTAATAAAACCGAATTCTTACGAATAATATTTCGAATACCCGCGCTTTTTAGCGCCTCCCTAACCTGTGGCTTTTCGTTGGAACCCCTGGTCTAAGCCGGTTAAAACTCACCGCTGAACCTGCTGGCCCACTGGCCAAACGAATGCTCGTCCTCCCGGCACCAAAAGCGGCTTCATGTAGCAGCACCCTGCGCAGAAAACAAACAAAAAACACTTTGTTTACAAAACATTGCAGCATTTGGATAACAGCACCGCAACGCCGTTCAAATGCGCACGCATGGCTTCGGACTGCCGCATATTCAGCT ACAACAACATTTGCGGTACACAAAAATCGATAGTGACGTCACTTGGGGTGGGGTGTATATATATGTGTGTGTGCGTGACAATTTCATTTTTATTCACTGACTTATTTATTTAATCGATTTGACATTATTTTGAGCATATAAGGATCGTGTGATTTACCAGAGACAACTAAAGCCTCGTTGGGGCCGCAGGTTACAAATCCCCAAGTCATTTCTGCAGCACTTATTTGTTATTTATATTAGAAAATGGGTTGCTGCTGATAACAGCTTTTGTTTTATCTGCGCGGTTAACACAGTTTTCCGATTATTAACTATATAGCGAATTATCCGATCCACAGGTAGCCTTGTTTATTCGTCTAATAATATATATAAAAGAATTTCCGAGGTACTCGGTGCTTAAGATTCAGAAATCCGACCGGTTCGGTTAGCAATTCGTAGCACAATAAAAAAATCTCTCAATCTGTAAAGTTCTCAATTTCTAACTCGCGAGTGCGCAGAACGACTTTAACCCCTATTGAGTGCCGGGGGTTGAGGCGACCACTTCAAAATATTCATCATGCTGCGACGACGTAGTGCTGCGGTAAGTGTCTTTATTGGTTTAAAAATCTAGGTTACATCTCAATTTTTTTTATTCTAATTTACTTAATGACTCATATCATTCAGAAAGATCGAAATTCTTAAAAATACACAATAAATGTAATAAGAAAATCGTCGACACTCATTAAATTTGGAAACCAGATGTATTGCCTAGTTTTTAGTCTTTGAAAACAGAAACTAGGATTTCAAATATTTTTTCCACATTCACACAAACAGTAGATATCGTCTAGGAATTTGAACAATTTTCGGATCTTAACGATACACTCAACATAAAAATTTTTAAGAATAAAACTATTTTACTGAATCAATAAGTATTTTATCGATAAATGTTAATTTGGCAGCTCAAATGGCTATATTAAGTGTCACATTGGTAGGGATTGTCATAAATCAAACCTTTTGCTTTGGTAAATCAAACTAATGAAATTATAAAGAACTTTTTATCTTATACTATAATCGAACTCTACTGCAAGGACATACATATATAATTAAAAGATCTTTGCTGGACAAAGTCTCGCAT


Search Again