CR00781

CRIMIC CR00781

Gene frj

CG9526

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK80657

Images

Construct Sequences

sgRNA sequence
ATAGGAAACTAGGTTGAATCTGG

Amplicon 5' Amplicon 3'
GAGCATCGACGACGTCATCTATGTGATCTGCCTGCTGGGCTGCATCGGAGCCGGCAGCTATGTGAAGAAGATCGCGGACGAGGGCCAGCGCAAGCTGGTGTCCACTGGGCTAGGCGTTCTTGTGGTTGTCATTGTCTCGGGGCTCCACAGTCTGCACTGCTTTGTTTCCCTGGCACTGGGCACGGCCGCCGTGCTTCTCGTGCACCCGAGGTTAGTTGGTGATCCTGAACCTGTGGAAAATTACCAATAACCACACTGCTCCCTCTTCCAGCAAGGGTCACCTGGTCACGTTTGCGGTCATGTTTGGCTACCTGGTGTTCTTCCGCATTTTCGACTTCTACTTCGGCATTCCCGGCCACACGAACATGATACAAATGATACTAACACTAAAGGTGGGTTGCATAACCATTCATTGCCATTACTTAGCTCGTAATCCTTGCATCGGCAGGTTTCGGGCATTGCCTTCGAGAAGACTGCCGCCTGGAAGCGACTGCAAGCGCACGACGAGCAAAAGAAGAACGACCAGCGGGATGTGCACCAGGAGAGTCCAATCGAGATCACCGACTACGATGTGGAATTGCAGAGCCTGAGTGCCGCTGAGATCCTGCACTACAGCTTCAACTACATCGGAGTTCTTACAGGTG CCTAGTTTCCTATCCACAAGCACTAAAAATGTAGTCACAATACAACCAGATACCAAAGTCCAATTCAATTGCTGATTGTAAAACATTACACACACATGCTTATAATCGATTTCAACCGCATCAATATAATCATCAGTATCAAGTAGATAATAATTTGTAAATCTGCATTTAAAACGAAACCACTCATGTCCATTGATTGCAGGTCCCTATTATCGGTATCGCACATACAGGGACTACTTTGAGATGCCTTTCAAGACCTACGCTCCAACTGTTGAAGCCACCCTGGAGAAGCTGAAGTACGCCGTCTTCTACTGCGCATTATACCTGGCAACCAACTACATGTGGCCACTGGATGTGAGTGCTTGAGCACACCGCAAAACATTACTAAATTGAATACATTTCAGTATGCGTTGAGTGATGAGTTCTTCAACGATCGCTCCTTTGTGTACCGTTTGCTGTACGTGTGGCCCACGTTCTTCACATTCCGCGCTCGCATCTACACCGGACTC


Search Again