CR00780

CRIMIC CR00780

Gene CG8677

CG8677

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK80656

Images

Construct Sequences

sgRNA sequence
GCCAAGCACGCTCTCCAGAGCGG

Amplicon 5' Amplicon 3'
CCCGTACAAGAGCTGTCTCGCGGCAAGAAATATGCACCCTCGAAGTCTCGCAGTGCCGTGCGACCAGAGAACTTGATCCTTGGACAAATGACTCGTGTTTGCAGTGCCCGTTTTGAGGTTTTGCCAGAGTAGTATACAACACCCGAAAATTTTCGCTGGTTCTCGGGGACGCATGAAAAATGGCGGCGTCCTCAGCTGCGGCTGCGGCGCCCACCAATCCGATCCCGCTTCCGACGGACTCCATATCGGAGGAGTGCAAGGACGACGACGCCCTCACCTCCACGCTGCACACATGCGCCAATGATCCGGACTTTGCGGTCATTTGCGCCTTCCTGCAAAAATTCGGCAAGGACCTGGGTCTTAACCTGCCCAACTTCAAGCATCTGCAGGAGTGGTTGACAAACAACAACGATGGTGAGAGGGTGGGGTGGTGGTATCAAGAGAGCGGGGTGGAAGCAGTTTTTTGCCAAATTAATTTATGTCAGGTTCAATTATCGTGGGGCAAGTGGCGGTGGAAACTACGGATGTAGTGTTTTCGAATAGGTCTGCTCCAGAGATTTAACAATGCTCCGCTCTGGAGAGCGTGCTTGG CGTGCTTGGCTCGTCAGAGAGAAAGAGATTGCTCAATGGCAGAGAGAGCACTGCGATTTGTTTTCATCTCAACACAAGCGCAATATACAAAACAAATCTGGGAGAGACGTAAATATTTCCCACATTTGCTCTGGTCTTCTTATTTGAGAGATAGTAAGAGAGCTACAATTGAACACTAAAAGTTGGTTTTTTTTTTTTAATGTACACCTGCATCTGGAAATATATTAAATATTTAGGGTCACGAGTGGGAGGGAACCTGAAAATATATTTGTTTAAAAAAGTTATAATCATGCTAAGTTTCTACGTTTTGTATGTATTTGCGTGAGCAACAGCAGACACAAAAAGTGTACACTACAACAAACGCGGTTGCATTTATTTCACTTGCCCTCATAATCCACCCACAATCCATTTATATTCCGCTGTCACTTTCTTCCTTTTCGCAGAACTTTTACTAATATTTAATTATAACGAATCTTTGTAGTTCCTGAGCTAAGGGACTTGCACATAAAGCTGCTCCGTAAGACCCGTAAGACGGTTCACGAAAAGAGTTGGGAGTCCGCCCTCAGCAAATTCTGCTTCGGCTACTCGGTGCAAGATGCCTGGGAAATCGAACGTTTCGGTTATAGGAATTCCAGCTTGAAGGTTAAGCTGCGAATATTTCGGGTGAGTAACGAATTTCGTACCACTTGATAAACCGTTCTAAAGGGCGTCTTTCCCGTACAGGAACTTCTCGAAAGTCAGTTTGAACGCAATGCCAAGTTTCGGGCCCACATCCTCACCTTGAATGCCGATACTTTACGCTCTGAGCCAATTGGAAGGGACCGGTTGGGACATGCCTACTGGCTGACTCAGGATGCCCACTGTAATCTGCGGATCTACCAGGAGCATCTAGACGAGGAAATTTGGCAGGTGGTTGCCACGAACAGGGACGAGTTTGTAAATCTCATTTCAAGGCTGCGCGGAAATGAGGTGGTACTTCCTTCGAAGGACATTGGTGAGGCCGATGAGGACACCAGCAGCAGCAACAGTTGTCATCCCAAACCACCGCCCCCCGAACAGAAAGAAGAAGAGGACGATGAGGAAGTTGGAGATGAGCCCGAAAAAACTGTACCCAATCTAAAGATTAAACTCCGCTCTCCCGAGCAAGAGGATCA


Search Again