CR00778

CRIMIC CR00778

Gene rdgBbeta

CG17818

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK80655

Images

Construct Sequences

sgRNA sequence
CAGGAGGGAAAGCCCGCCTCCGG

Amplicon 5' Amplicon 3'
GGCCATGGAGCTGGTAATGTGAGTCAATTAAGCAAATGGATCAGTTATTAAGTCCTTAACTATATAAGATACTATATTAAAAAACAAGAACATTAAGGCTTATCAAAAGATTTAAGCCTTTGGTACGAAGTCCCAAATAAACGTTAAAAATTATCCCTATGATATGAGAACTTAGAGAACTTATTATAAGCAAATAGTTAGTTCGACATACATAGATTATAACTAAATCTTCGCCTTTAAAACCAATTTGTTTTGCAGGCACTTAAAAGGTAATTTCCCAAAGCCACTTTGGGTAAACAAACCAGCTAGAACTGTATTTTCCCCTCGAAGTCAACGACCTGCTGGAATGACAATCCCCAATCGAGTGCACAGAGTTTAATCGGATGCATTAAGCACCGCGTAATCCGATTTTATCAACATATGCGCTGGGAATACAGGCAGTTGCCAACAAATGCCGAACGGAGATTGGAGCAGCTGGCCATCAAGTGCTCTCCTCTAGCCCCATCCAAACCATATCGGTGACGTACTGGGTGCGTAAACAGGTGTGAGTTTAATGGAGCGCGCTTATCGGCAGACGTACCCCACCATATTTGTAATGGTCTAGTGATAAAGCGGAATTCTTGCTGGCCCCCAAAAATCACACGATGTTCCTAGAACGCTTGCCATATGGCTATGGTAAGATGGCAGGAGGGA CCTCCGGAATACACAATTAGACTAAAAATAGACTGGGATGCGCAGTAGGTGGTGGTGGGTTACTGTCACTCCTCACCTGTTAGCGTGTACGGATAGTAGTTCCATGATTTCTCTATCACATAGAAGACTCGGGGGCAAATGGCCTGGATCCAGTAGGGCAGTCGGCTGTAATGGATGTCATTTGTAGTCGGATATTCTACAACTAAGTAGCACCTCTAGAGATTCCCACCTGGACAAGTGAATGTGCTTCTCCGTGTACTGGCCCTTGCCGTGAACGGGATCCTCGCAGGGCTTGTTCTCCACCACCTCAACGCCCTCGCCCTCCTCCGATTGCTCCAGACTGTGGCGCGCTATCATATAAAGCTGTCCGATCTTGTACTGTAAAGTGATGAGATAAAAACTTTATTTCAGACAATATTATGAAGGCAAAGTACAAGCGGCCACACACCTCCTCCACCGTAAGCGGCATGCATACGCGATACTCCTTGATTAGCACCATTTCTTTGGCGGATTTGTATGCCGGAGAAAATACAAATCAAAACTTTGAACGTTACGCAAAGAGACACACACGCGAC


Search Again