CR00771

CRIMIC CR00771

Gene bsh

CG10604

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK80654

Images

Construct Sequences

sgRNA sequence
GCACTAAAACTCGAAATATTCGG

Amplicon 5' Amplicon 3'
CCGACAGATCCGGGATTCAGTTTGCCGTGCTTGGAGTCCCCGGATGAGGAGGTGGCCTCGCCCGGCTGCTTGCCCGGTTCGCTGCGTGAGAAGTCGACGGGCTCTGCGGCATGGAAGAGTCAAAGAAATTTCCACAAAATTTAGAACTAATTTGATTTGCGTTGAAACTTGAGCAAAACTTTTTGCATCACAAGGAGCCGGCTAAAAGCCAAAAGGTCTAATTGATAGTCCAAAAGTTCCTCAAAGAAACTACTCACTCCAGTGGTCTAGTTTTTGGTGCTTTGTGACCAATTTGAAAACCGCTGACCACTCCTGCTCGAAATGCCTTTTGACAATTTAATTGCTAACTCAAATATTGCATTGTCTAAAAGCTGGAAAACTTGAGCAACTCTTTTTCGCTCTAGTTGTTCTTAACAGCCCAGAAAAGGTTTGAATATTAAATAACTTGATTTGAGTATTATAAATTTCGTAATATTTAATTTGCTCATAATAAATTTGTGATTATGAAATCAATATACTCACCATTGGCATTGTCGCGCCGGCGCAGCTGCTTTTTGTGCTTCATGCGGCGGTTCTGGAACCAGGTCTTCACCTGCGTCTCGCTGAGTCCCAAGGCGGTGGCCAGCTCCACACGCTCCGGCGTGGACAGGTATCGCTGTCCCTCGAACCGCTTTTCCAGACCGGACAGCTGCGGATCACTGAACACCGTGCGAGCCTTCCTCCGGCGGCAGTGGCGCAGGGCATTCACGCCCATTCCCAGTCCGAGGGCCAGTTCCGGCACACAGCCAGGCGCTCCGAAGAAGGGCGCTCCCCCGAACAGGCTGGCTGAAAGGGCAAAGGATGCAAAATTTGGTTAACTTCGTTATAGTTGGAACAAATGAAAACTTTCGGTGTTGATGGCCATTTACACCGAA AGTGCCCCTAAATGAAGCTATGTGGCAACAAAAAACTGCACTTCAACATCAGTTGTCCTACTAATTTGGGTTTCATTTTGAAAAAGTTCTAAATGTGAAATTAAATGTTGTGCTGGCTTTTTAATGAGAATATGTCCAACTTCATTTTCGATTAGCTAAACTCTAGCTAGAATTGACTTTTAATTTCTATGAGTTCGACTTTAACTTATTACCAACATGTTTGTATGTACCAGTACAAATCAGAATCATCTAGGAGGATATCTCTGTAATATCGAGCATTAACTCACCTTGTGATAGAAAATAGGGATCCACGGACTTGTAGGTGCCCGACGACGGCGAGAGATATCCGAGGGTCATTTGAAGAAATCCGTGATCGGTGTAGGGTGCATTCGGATAGAGTACTCCATTGGATGCACCACTACCTCCATTCAGGGGCGGCGGAGGCGGAGGTTGAGGTTGAGTCGTGGGCACCGGCGGATGTTGTGCTGCTCCAGATCCCAACTGCTGCGAAATCTGATCTCCGTTGTAGTGGGAAGTTCCGTGTCGCGAGTGGTGGTTGGACCTACGAAGCA


Search Again