CR00769

CRIMIC CR00769

Gene inaD

CG3504

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK80653

Images

Construct Sequences

sgRNA sequence
TTGGTCATGAAACCACTCAATGG

Amplicon 5' Amplicon 3'
ACCTTTAGGCGACCACACAGATGCGCGGGACTGTCGGGCACAATGCCCTTGATGAAGATGCCGGTGGTCTTGGTGTTGGGCGAATCCTTCACCTCGCCGCGCACTATGCAGATGCCGAAGGACTTCTTGCCCGTCTTGTCCAGGGTCACCATGTGAATGAGCTCTGGGAAAGGATTGTGCATTCCAAATGAAATAAAAACTATTTACAACGTATTGTTAAAGTACGACTAAGACAAATGTGAAGCTATTACTAATAAATATTTATTGGGGTCCTTATCCCACTTGGTATCCTTTCGCAAAATAATTTTCACCAATATTGTATAATCGTTTATATAAATGTTAAGGTTAAGTTCATTACATAAACATATTTCTCACAGGATTCTTAAGAATCAATAAAGTCAATTGAATTGGCTTTTGTTCAAATTTTGTTTTATTTGATTCATAAAACACAAAACGAGTATTGAGTGACCTTTGGAAGGTCAAGTTCTTTCGGGACTAGCTGCAAATTTGATTAGCAGTTGGTCATGAAACCA TCAATGGACACTGACCACCCGCGGTGCCCTGTTTGCCCAGGAACTGAACCATCCTCGCTGCTTGAGATCGACTGCTCCGTAATCCTAGCCAAAAACTCGCGACTCACTGACCGGACATTAAGCGCACCGAATTAAGCTCAAATGTAATATCGAATATTTATTGTTATGGGTTTTCACTTAATTATTATTTGTGAATATTCCGCGTTGGCTGCGCCCGATTTGAGTCCATTGAAAAGTGCGCCTAAACTGATTTTACAATTAGCGGGCGAACATTCTTGCTAACTGACTTAGTGGCCATTCTATTTTGAGTATGATTTTCGTATCGATTACACTGGTCAGCAGGGTTGATCTTAGAGTACCAGATGCATGTAGTTCATACATATATGCTAAGACACTTTCACAAACTTTCCTTCTAAAGAATGCTTGAGTAAAAGAAAAATTCTACTAATAATAATGAAAATGTTTCGTATCTTGAGATTACCCATTAAAATATTACCTTGCAGTACAGTGCTATCGATTCGGAGGAGGTGCCTCCAATGAATTGAGTAACTTTCACTGTCTGTTATGACACCACTCACAAAACACCCAGCTCCCCGAAGACGGCCATTATATGGGTTACCATCGCGGATGTGAAGGCTAGGGGAAAATGGATACCCATGTACCTTTATTGGCCCTATCAAGTTATTAATTTGTTGGTACGATTTGGCCCGTGCTGAACTCAACACTCCGCCAGGAGAAGCCCACCAAGTGTTGACCAGCAATGCCCATCGATTTTATATTTTTCTTTCATTGCACTTACAACTGAATAACATATGTCTCACACACTTTTACCTGGGCGAGAGC


Search Again