CR00768

CRIMIC CR00768

Gene mle

CG11680

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK80652

Images

Construct Sequences

sgRNA sequence
TAACCTGCATTCAAATTTCTTGG

Amplicon 5' Amplicon 3'
GAAAACCTTGCGTTGCTCGTCTCGTGGAATCTGCGAGTGGCACGGCAAAATTTGGTATTGGGATGTATCACCAAAAATGTTTGTATTTTGCAGAAACTTCATAAGCGCAAAGATCAGGTTCCAACCGGGCAGGAATACTAAGATAGCACCGGGAATATTTTTTGACTTAATATGCATCAATAATGCCTCCAGCAGCTCAAAGCTAACGTCCGATTCGGATAGCATGGCCATAGCATTTCGAGTCTTTTGTGAATACTTGTCCTCGCACACCTTGTTATAGTTGATTTCCGCCTCGTCCTTGTCCTCGGAAAGCAATTGCTCCTCGTCCTCCACTTCCTTGCGCTTTCGGCGCGACTCCGCCGAAGGCACAAAGTCTGTCATCTGAATAATGTCCTCCAAGAAAAATTGCTGCACGGGAAATGCTCTTCCGGGTACTTCCAATACGGGACAGATGCCAAAATATTTGGAAAATTTCGTTGTATCAATAGTGGCCGACATAAGAATAACTGCAATAGAAGAGTTTCTATTAATTATAGTGTTTTCTAAAAGTCATATCATATTAAATTAGGACTAGAAATGTATGACCCGTAATGCATATAAGTTTTAAGTTCTGAATAGTAATTTTGTTGGGCATAAGTAATTTTGGCAAGTCAACTCTACATTAAATATGAAACACAAACAATTGGCAATGCAAATTTTCAATGGAACAAACTGACAAATCGACTATTAAGAACATAACATATACACTCTGGGCGGATCCGGTACAAACAATATAATCATAATCTTCATTAATTAAGCCAGTGAATTAGTGCAAAATAAGTTATTTTCGCGGCTCAAAATCTGCTCAACATTGCTTTTTATACATGTAAATGTATGTATATATACAATACATATATACAAATGTATGTATATATAAATATATAAGTATAATCAACAATTGTCGAAGAGTTTCACCCCA TGAATGCAGGTTATACATACGGATTTATGTTAGAAATATTGCACCTTATTCGAGCTTACCATGCAGGTCCGGATATGTGTCGACCATGTCGCGAAGGATGACCAGCAAAAAGTCGCTGTTCACGTCTCTCTCGTGGATTTCGTCCACAATAATATGCGACACTCCTCGTAAGCCAGCCTCCAGCTTGCGCAGCAACACACCCACGGTGCAAAAGAGGATTGCGCCGTAGGGTCGTGGAAACACAGACTCAAATCGCACCGAGTAGCCTACAGTGTCGCCCAATTGCTCGCACCGCTCGCGAGCTACGCGCTCGGCCACAGAAATGGCTGAAATGCGACGAGGCTGGGTCACATAAATATTAGCGTACCCGCCCTGGCCGGAGCAGATGTAGTCATCAAGAATGTATTGGGCAATCTGGGTAGTCTTTCCGCACCCTGTGTTTCCACGAATGATTACCACTGGATTGTCATTAATTGCGGTTAAAATTTCCGACCGCATCGCTGCAATGGGCAGCTTTTCGCGGAACTCGAGGAATTGTCGGTACTCGTTGTCGTTTTGGCGGCGATCACGCAGCGAGCGTTCGTAGTCCATCGAAAGGTCATCAATAGAGGTGGTTGCCAGTTCGCCTTCGTCGATGTTGCAGGCATGCCACGTATTCCAGTTTGCCTGAGGAGGAGCCCACGGAATCACGGAGCTTTCCTGACGTTTTTCGCCATCCTGTTGCG


Search Again