CR00767

CRIMIC CR00767

Gene net

CG11450

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK long band80651

Images

Construct Sequences

sgRNA sequence
AAGACGAGGCTTCCCACACAGGG

Amplicon 5' Amplicon 3'
TGCGGACACACATTTACGGAAGGTAAGCTTTTTGCATGTTTATTCAACTATTTATAAGCACAATATTCTGCTATCTTTTCTAATTTTAGGCAGATAAACAACGAAACGAAATTCAAAGCAACTGACTGACATTGCGGCCACGAAATCAGGCTGTACAAATAACATCAGTTTTATAGCCCTAACTCTATCCCATGTCTTGCGTGGTTTATATACCGCATTTTAATTTATATTTAGACAAATGTTTACTTTTAAGCCACCGTCCTCGCAGGCGTCGTCTAGTTTAAAACACCTGTGCCAAACGGAAACATTTTTAAAGCTTGCCAAGTTTTTAAAAAATAAATTTCTACCAATTTATATTTAAGTTGTCCGTATCAGACACTTAAAGTTACATCTAACGACCAAAGGGCAATACCTGCACATTTTATTTTATTTTTAGTATACACGGAAGAAGGTATTATTCTCGATTGTTTATATTAAGAATATTTTAAGATGTTTTTTGTACGCCCAAATTAGTTTATTTTTTATGGATCTGATCCGTCTTTAGGTGCCAAGTACAAAATAGCAAGTTTTGCTCAGAAATTGACAACGGTTTTCCCGTTATTGGCCTTTTTTTCTAAGAATGAATGCCCTCCTGCGAAAATCAGCTAAAACCTACTTAAAAACGGCAGACATTAACTGTCAGAGGCATAAGAAAATCCCATATTCACGCCAAAAGTCAACGAAAGGTTATCATCATAGGCGGCTTTTGGCTGGCGGTCGGTCCACTGGGAAGCGTTCCCTGTGTGGGAAGCCTCGTCTT GTGGGAAGCCTCGTCTTATCATAACAAGTGCATATACTCATACGTACATAAATGTAAATATGTTATAGCGACTATATGAAATATATTGTAGTAAAATGACGCATCACTTTTATGAATGAATCGTAAGAACACATCCAGATCATGCAGTACTTTGACACACTTGGTAAGGACATTTTTACGTTGGTTATAAAACGAACCCAATATCATTCGGCTTTCCTGTTACTACATTGCGTTATGTAGTAAAATAATATAAGTGGAATTTTTATAAACTCATAGTGATCAATTTAAATTAAAGACACCTTATTCTATCCAAACCAATGGCCATCTAGACTAATCATTTCGAAACGTTGCTGATTAAGACTAGCATTTTAAATAAATGATCACAGAAACAAAAAATAAAATCGATTTTATGAAATGCTGACGTAAACAGTACCAACAATATGGAAGGAGTTAACGTCTGTCCTCGAACATTATAACAATCAGCAGGCGGTGGTGAAAAGGGACACACAATGCAGAGTCCAACTGTCGCTCCAGCTTCACAAACAGACAAATTGCCAATATGTCTGGCGACATCGTCGTCCCAAATTCGCCATTGCGGGCAAAGTGCTTGGCCGACATATGCAACACAAGACGAAAGTTGGAGTACGCTGGCGACACATAGTTGGCTTTATTTACGTATCTGTCTGCATCTTAATTGCCATCCTCACAAGTCTGCT


Search Again