CR00765

CRIMIC CR00765

Gene Rme-8

CG8014

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK80650

Images

Construct Sequences

sgRNA sequence
GTGCGGAAGAAAGATGAGTGCGG

Amplicon 5' Amplicon 3'
GCATCAAATTCGCCTCCGTCTCCTCGTCCACCGAGCTGTTCAATGGCACATACCGTTTCCCTCGCGGCGTGTTGCCAATGCGGACGTGCACATCCTGATTGCCACTGGAGCGGACAGCATCCAGAACAGTGGCCAACAATGAGTCGCGGTCGTTGGTGCTGTAGTTGCGCACGATTCCATTCTTGTACTCGATGCTGAAGCGCTGAAGATTGTCCTTGTCTCTAACTAAGGCAAACACATCAGTGAGCGGACGCAGGGTGCAGACGCTGTAGGTTTGAGGATCCCGCTCCAGCAGCGTTACCTCGGTGAGGCAGAGTATACGCTTCACCGGATCCGGATGGCGGGGCGTTATCTTATGAACCGAGAATTCGGTCGACGAGGTTTGAAACTGGTCACCACTGAAATATTATATGGCTTTTTTTTTCTACAAATTCTTTATTGCGTTTCACATGAACTTACCTAAACTTGCCGAACCGCTGCCTCTCGAACTGCTCCAGAGTGATCTGACTCTTGAGTATTTTGGTTTCGATGCCCAGAAACTGAGCCGATCTCTGTGCTATGTTCTGCACGATTTCGTGGTGATTCAGCGCCTTAAACAAATGGAGGCGACTGAATCCGCCGTAGGCCATCACGATTCCTCCCTCATAGTCCGAGATGCCTGCTTAAAACGTGTGC AGTGCGGCAAGTAACCAAAAATAAAAAAAAGAACAAAACACGGAGCGATCATATTGAATTGTAATTGAGGCACATGAGGACAAAACAAGACACATTAATTGATGCAAGCGAGTCGAATGTGCATAGCTACCTATTATTCCCTCGATATCCTTGTACATATAGCTGGCCAGCACGTCGTTGGTGGTGGGATCGAGCTGGTCCAGAGAACAGGGCGTGACCTCCAGTACTGTGGGAAGACTGATGCCCGACCAGTGGTATTTGTAAGCACTAAAGCGCTACAAAATTTAGATAGTATTCAAAATTAAAATTTTGACAGATTAGAATTCATATTGCATATTTAAATGTTAATTAGAAACATCTGAATCACACATGAAATGTTGGAGAAGTGTTTCCAAATTAGTATAGGATTTAAAGCGAGACTCAAAAACCAACCTGAGCATTTTTCGGCTTGTCCGCAAACTCTTTGTAGTACTTTAATATAGAGCTTAGGATATCGTTCCGATATTCCGACGATAACTTGATTGTATCTAGTTTCTTATCCTTTTTGATGGTAATCACGAAGTCATGGGGTATCTGAAAGATCAATTTATTTAGTTCCGAGCTCTCCGTAGGATCTTATAAACTCACATTTGTGGTCTTTGAGGGTGCTGCTGCTACGATGTCCGAATAGGACCACCTGTTAGTCAGGTCAAGCTTGTCCGGATTGTAGGTGGATATGCCGGCCGTGCCGATGGAGAGGATGCGCTTATACCTGCCCT


Search Again