CR00763

CRIMIC CR00763

Gene RabX1

CG3870

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK80648

Images

Construct Sequences

sgRNA sequence
TGAAGCGAAATAGGGCTCACGGG

Amplicon 5' Amplicon 3'
AAGCATTTTGGGGCAACGACATGTTCATTGGCGAAACTAAATCGAAGCACACAAAAGCTTACCAAAGAAACAAAGAGCCCCGCAAGCGAATCTAACAAGCGGAATACGAAAACTATATCCTATTATGTATTCATACTTATTGTGCGCCGGCGACTGCTTCTGCTGGTCAACTGGGGTCAACCGGGGGAAAAACAAATCTGACCTGTTTCTTTCAACATTCTGAGCAAGCACTTCGTCCAAGAAAAAGTATTGCTTTGCTGAAACGCTATGTGATTGGATTAAAGAGCTTGAATTCTATTCTACTAAAAAGTTTCAAACTTTCTCAGTTTAAAGCCTATCCACCTAGCTGCCTGTGCATCCATGTTAGAGAAAAAACAGTTTGGCGTTGAGAGTAAACGTATGGCCATTGTAGTGGCCATTGTTATATGGCTGCGCATAAAATCGGGATCACCGAAGAGTAAATACGGCAGCCAGGGCCAAGTGGGTGGTAACCCTTTGGCAATGGGCGAAGCTGGTGCTGCTGCTGCTCCTGCTACTACTGCCGCTCCCGTTTAGCTTATCAATAAACTATAAAAAAAAAGGAACGAGCTAACAAAAAAGAGAATAACACAAAGTGCAGCGGACGCACAAATTGCAAACAAAAAAGGACAAATAAAGTGACCAAAACAGTGGGCGGCGGAGACGGCGGACGAGAAGTACCCGCGGCGCAGCCAGTGGCAGAATAAACCCAGATTAGCGTTCCGGCAGCCCAGCCGGCAAATAGGATTAGTGGGCGCGTGGGGCAGTGGCAAATTCCTTTGGCTTTGCCTTTGGCTTCGGCTTTTTTACGAGGCAATTCCATTTGCGTTCGCCCCAAAAGAGTTGGTCGCACTGATACATATTCTGGCTGCTGTATACGCACTTGCAATTTAATTTTGACCTCGTCCAGGATGATGTTGCACGTGAAGAAGGACACGGCTATCGTGGGTACCTCGCTTTCCTTGCGGTGCAGCGTGTTCTTTATGTAGCGGATGACCAAACGTGTTTTGCCCACACCTGCAAGACAAGAACACAAATTATGCAATTAATCGAGAGATACAGCATTGTCTTTCTGTGTACCCGTGAGCCCTAT CGCTTCAAGCATAATGCCGTGCAGCTTATCAGTGAACGTGGAATGGCGCACGCATTAATTGACCGCTGATTAATCACGCAAATTGAGCCGAATAAACAAAACAAAAACTGGAGACGCACTAGCCCGCAAAAGGTGGTAAACAGCGATAAGGAATCGCCTACCGACCACGAGATTCTTTGTTCGGCGCCCACTTTTTTGTGGCTCAGAGAAGCCCCTCTGTGTTTGATCAGACGGGGAATCTCCGCGTGGAGCTGCAGTATGTGCATGCACTGAATCATCCGGCGATTATGGGAAGAACGTATATTCCGAGGAAAGTACCGCCTTTTTTTTATCAATGCGTCCCTTTGTTTGGCGAAAAAGCAGAGCAAATACTGCACCCGCTGTGCATATAAGCCCCCTTAGTTGACCTTGGGCCAAACTTAAATACATATACTCATTGCGAATTCGTCAGCCGATTACGCTGCAAAAAATGTCCACTTTGTTGTGTAGAAGAGGGTAGACGGTGGAGGCTTCCCCCTTGATATGTTTTTGGAGTACAAATGTAGAAATGAACAATTTTAAGTTTCGGAGTTGTGCACTACGGAAGCCAT


Search Again